Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU107281

Sigma-Aldrich

MISSION® esiRNA

targeting human ESRRA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGCTGTCTGACCAGATGTCAGTACTGCAGAGCGTGTGGATGGAGGTGCTGGTGCTGGGTGTGGCCCAGCGCTCACTGCCACTGCAGGATGAGCTGGCCTTCGCTGAGGACTTAGTCCTGGATGAAGAGGGGGCACGGGCAGCTGGCCTGGGGGAACTGGGGGCTGCCCTGCTGCAACTAGTGCGGCGGCTGCAGGCCCTGCGGCTGGAGCGAGAGGAGTATGTTCTACTAAAGGCCTTGGCCCTTGCCAATTCAGACTCTGTGCACATCGAAGATGCCGAGGCTGTGGAGCAGCTGCGAGAAGCTCTGCACGAGGCCCTGCTGGAGTATGAAGCCGGCCGGGCTGGCCCCGGAGGGGGTGCTGAGCGGCGGCGGGCGGGCAGGCTGCTGCTCACGCTACCGCTCCTCCGCCAGACAGCGGGCAAAGTGCTGGCCCATTTCTATGGGGTGAAGCTGGAGGGCAAGGTGCCCATGCACAAGCTGTTCTTGGAGATGCTCGAGG

Ensembl | human accession no.

ENSG00000173153

NCBI accession no.

NM_004451

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ESRRA(2101) , ESRRA(2101)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiumin Huang et al.
Cell adhesion & migration, 12(6), 538-547 (2018-05-22)
Estrogenic signals have been suggested to be important for the tumorigenesis and progression of endometrial cancer (EC) cells. Our present data showed that estrogen related receptor alpha (ERRα), while not ERRβ or ERRγ, was significantly elevated in EC cells and
Peng Chen et al.
Journal of cellular biochemistry, 118(1), 74-81 (2016-05-28)
Curcumin has demonstrated valuable therapeutic potential against a variety of human cancers including osteosarcoma. However, the molecular mechanisms underlying its anti-tumor effect remain to be poorly understood. By RNA sequence profiling, we found that curcumin significantly down-regulates the expression of
Kaori Yoriki et al.
Scientific reports, 9(1), 6697-6697 (2019-05-02)
Estrogen-related receptor alpha (ERRα), which shares structural similarities with estrogen receptors, is associated with tumor progression in endometrial cancer, but little is known about the detailed underlying mechanism. We investigated whether ERRα, in cooperation with peroxisome proliferator-activated receptor gamma coactivator
Ankana Tiwari et al.
Scientific reports, 5, 17621-17621 (2015-12-08)
The ESRRA gene encodes a transcription factor and regulates several genes, such as WNT11 and OPN, involved in tumorigenesis. It is upregulated in several cancers, including OSCC. We have previously shown that the tumor suppressor miR-125a targets ESRRA, and its

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico