Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU099351

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAATGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiajia Li et al.
Biochemical and biophysical research communications, 523(2), 434-440 (2019-12-27)
Ovarian cancer is the most lethal gynecological malignancy, but the mechanisms of ovarian cancer progression and cisplatin resistance remain unclear. Emerging evidence suggested that ubiquitin-conjugating enzyme E2C (UBE2C) was highly expressed in a variety of tumors and acted as an
Masanori Saito et al.
Scientific reports, 6, 20622-20622 (2016-02-11)
Skeletal development is tightly regulated through the processes of chondrocyte proliferation and differentiation. Although the involvement of transcription and growth factors on the regulation of skeletal development has been extensively studied, the role of cell cycle regulatory proteins in this
Gabriel Kollarovic et al.
Aging, 8(1), 158-177 (2016-02-03)
Excessive DNA damage can induce an irreversible cell cycle arrest, called senescence, which is generally perceived as an important tumour-suppressor mechanism. However, it is unclear how cells decide whether to senesce or not after DNA damage. By combining experimental data
Tatyana S Nekova et al.
Cell cycle (Georgetown, Tex.), 15(23), 3203-3209 (2016-11-11)
Small molecule inhibitors targeting CDK1/CDK2 have been clinically proven effective against a variety of tumors, albeit at the cost of profound off target toxicities. To separate potential therapeutic from toxic effects, we selectively knocked down CDK1 or CDK2 in p53
Maria Sokolova et al.
Cell cycle (Georgetown, Tex.), 16(2), 189-199 (2016-12-09)
To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico