Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU098591

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTCACGAGCTTTCCACAACAGCTATGTGAAACTCTGAAGAGTTTGACACATTTGGACTTGCACAGTAATAAATTTACATCATTTCCTTCTTATTTGTTGAAAATGAGTTGTATTGCTAATCTTGATGTCTCTCGAAATGACATTGGACCCTCAGTGGTTTTAGATCCTACAGTGAAATGTCCAACTCTGAAACAGTTTAACCTGTCATATAACCAGCTGTCTTTTGTACCTGAGAACCTCACTGATGTGGTAGAGAAACTGGAGCAGCTCATTTTAGAAGGAAATAAAATATCAGGGATATGCTCCCCCTTGAGACTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ji-Hye Yoon et al.
Biochimica et biophysica acta, 1864(12), 2356-2368 (2017-09-11)
Leucine-rich repeat kinase 2 (LRRK2), a multi-domain protein, is a key causative factor in Parkinson's disease (PD). Identification of novel substrates and the molecular mechanisms underlying the effects of LRRK2 are essential for understanding the pathogenesis of PD. In this
Zhongcan Chen et al.
Human molecular genetics, 26(22), 4494-4505 (2017-10-04)
Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself
Xiaodong Ding et al.
Neurobiology of disease, 98, 122-136 (2016-11-29)
Dominantly inherited mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common causes of familial Parkinson's disease (PD) and LRRK2 polymorphisms are associated with increased risk for idiopathic PD. However, the molecular mechanisms by which these mutations cause PD
Alexia F Kalogeropulou et al.
The Biochemical journal, 477(22), 4397-4423 (2020-11-03)
Mutations that enhance LRRK2 protein kinase activity cause inherited Parkinson's disease. LRRK2 phosphorylates a group of Rab GTPase proteins, including Rab10 and Rab12, within the effector-binding switch-II motif. Previous work has indicated that the PARK16 locus, which harbors the gene
Daniel Ysselstein et al.
Nature communications, 10(1), 5570-5570 (2019-12-06)
Mutations in LRRK2 and GBA1 are common genetic risk factors for Parkinson's disease (PD) and major efforts are underway to develop new therapeutics that target LRRK2 or glucocerebrosidase (GCase). Here we describe a mechanistic and therapeutic convergence of LRRK2 and

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico