Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU092951

Sigma-Aldrich

MISSION® esiRNA

targeting human CREB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCACGAAAGAGAGAGG

Ensembl | nº de acceso humano

ENSG00000118260

Nº de acceso NCBI

NM_004379

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CREB1(1385) , CREB1(1385)

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QDV
GXU
ATU
HOS
OUR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

L Yuan et al.
Neuropathology and applied neurobiology, 42(7), 607-620 (2015-11-04)
14,15-Epoxyeicosatrienoic acid (14,15-EET) is abundantly expressed in brain and exerts protective effects against ischaemia. 14,15-EET is hydrolysed by soluble epoxide hydrolase (sEH). sEH-/- mice show a higher level of 14,15-EET in the brain. Astrocytes play a pivotal role in neuronal
Supriya Srinivasan et al.
Cancer research, 78(21), 6146-6158 (2018-09-21)
Although smoking is a significant risk factor for pancreatic ductal adenocarcinoma (PDAC), the molecular mechanisms underlying PDAC development and progression in smokers are still unclear. Here, we show the role of cyclic AMP response element-binding protein (CREB) in the pathogenesis
Hui-Xia Geng et al.
Neurochemical research, 42(10), 2841-2849 (2017-05-17)
Neuronal apoptosis mediated by the mitochondrial apoptosis pathway is an important pathological process in cerebral ischemia-reperfusion injury. 14,15-EET, an intermediate metabolite of arachidonic acid, can promote cell survival during ischemia/reperfusion. However, whether the mitochondrial apoptotic pathway is involved this survival
Tao Xiao et al.
Stem cells translational medicine, 8(2), 148-161 (2018-11-15)
Fibrous dysplasia (FD) is a disease of postnatal skeletal stem cells caused by activating mutations of guanine nucleotide-binding protein alpha-stimulating activity polypeptide (GNAS). FD is characterized by high proliferation and osteogenesis disorder of bone marrow stromal cells (BMSCs), resulting in
Lu Song et al.
British journal of pharmacology, 175(14), 2968-2987 (2018-05-04)
Developing novel pharmacological targets beyond the monoaminergic system is now a popular strategy for treating depression. PPARα is a nuclear receptor protein that functions as a transcription factor,-regulating gene expression. We have previously reported that both WY14643 and fenofibrate, two
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico