Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU092661

Sigma-Aldrich

MISSION® esiRNA

targeting human FUT8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTCTGCAAACTTCCATTCTTTAGATGACATCTACTATTTTGGGGGCCAGAATGCCCACAATCAAATTGCCATTTATGCTCACCAACCCCGAACTGCAGATGAAATTCCCATGGAACCTGGAGATATCATTGGTGTGGCTGGAAATCATTGGGATGGCTATTCTAAAGGTGTCAACAGGAAATTGGGAAGGACGGGCCTATATCCCTCCTACAAAGTTCGAGAGAAGATAGAAACGGTCAAGTACCCCACATATCCTGAGGCTGAGAAATAAAGCTCAGATGGAAGAGATAAACGACCAAACTCAGTTCGACCAAACTCAGTTCAAACCATTTCAGCCAAACTGTAGATGAAGAGGGCTCTGATCTAACAAAATAAGGTTATATGAGTAGATACTCTCAGCACCAAGAGCAGCTGGGAACTGAC

Ensembl | human accession no.

ENSG00000033170

NCBI accession no.

NM_178154

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FUT8(2530) , FUT8(2530)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ming Yu et al.
Placenta, 75, 45-53 (2019-02-05)
Trophoblast proliferation and invasion are essential for embryo implantation and placentation. Protein glycosylation is one of the most common and vital post-translational modifications, regulates protein physical and biochemical properties. FUT8 is the only known fucosyltransferase responsible for catalyzing α1,6-fucosylation in
Kazuhiro Tada et al.
Surgery today, 50(7), 767-777 (2020-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is the most common type of pancreatic cancer. It is an aggressive malignancy associated with poor prognosis because of recurrence, metastasis, and treatment resistance. Aberrant glycosylation of cancer cells triggers their migration and invasion and is
Shu Li et al.
Viruses, 11(4) (2019-04-27)
Hepatitis C virus (HCV) is a major cause of human chronic liver disease and hepatocellular carcinoma. Our recent studies showed that α1,6-fucosyltransferase (FUT8), a key glycosyltransferase, was the most up-regulated glycosyltransferase after the HCV infection of human hepatocellular carcinoma Huh7.5.1
Ming Yu et al.
Scientific reports, 7(1), 5315-5315 (2017-07-15)
Glycosylation of uterine endometrial cells plays important roles to determine their receptive function to blastocysts. Trophoblast-derived pregnancy-associated plasma protein A (PAPPA) is specifically elevated in pregnant women serum, and is known to promote trophoblast cell proliferation and adhesion. However, the
Li Shen et al.
Cellular oncology (Dordrecht), 43(4), 695-707 (2020-06-01)
Radio-resistance is recognized as a main factor in the failure of radiotherapy in oesophageal squamous cell carcinoma (ESCC). Aberrant cell surface glycosylation has been reported to correlate with radio-resistance in different kinds of tumours. However, glycomic alterations and the corresponding

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico