Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU091461

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGACTTGGTTCCTTCAACCTAGAGAAAGTTGAAAACCCAGCTGAAGTCATTAGAGAACTTATTTGTTATTGCTTGGACACCATTGCAGAAAATCAAGCCAAAAATGAGCACCTGCAGAAAGAAAATGAAAGGCTTCTGAGAGATTGGAATGATGTTCAAGGACGATTTGAAAAATGTGTGAGTGCTAAGGAAGCTTTGGAGACTGATCTTTATAAGCGGTTTATTCTGGTGTTGAATGAGAAGAAAACAAAAATCAGAAGTTTGCATAATAAATTATTAAATGCAGCTCAAGAACGAGAAAAGGACATCAAACAAGAAGGGGAAACTGCAATCTGTTCTGAAATGACTGCTGACCGAGATCCAGTCTATGATGAGAGTACTGATGAGGAAAGTGAAAACCAAACTGATCTCTCTGGGTTGGCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wen Li et al.
Nature cell biology, 21(10), 1273-1285 (2019-09-25)
Chromosome translocation is a major cause of the onset and progression of diverse types of cancers. However, the mechanisms underlying this process remain poorly understood. Here, we identified a non-homologous end-joining protein, IFFO1, which structurally forms a heterotetramer with XRCC4.
Idit Hazan et al.
Cell reports, 29(3), 560-572 (2019-10-17)
DNA double-strand breaks (DSBs) are deleterious and tumorigenic but could also be essential for DNA-based processes. Yet the landscape of physiological DSBs and their role and repair are still elusive. Here, we mapped DSBs at high resolution in cancer and
Masahiro Terasawa et al.
PLoS genetics, 10(8), e1004563-e1004563 (2014-08-29)
DNA double-strand breaks (DSBs) can be repaired by one of two major pathways-non-homologous end-joining (NHEJ) and homologous recombination (HR)-depending on whether cells are in G1 or S/G2 phase, respectively. However, the mechanisms of DSB repair during M phase remain largely

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico