Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU089961

Sigma-Aldrich

MISSION® esiRNA

targeting human LYN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAGGGAATGGCATACATCGAGCGGAAGAACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATGTGCAAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGGGAAGGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTCACTATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGGAAAATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTACAGGATGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGGAAAGAAAAGGCAG

Ensembl | human accession no.

ENSG00000147507

NCBI accession no.

NM_002350

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LYN(4067) , LYN(4067)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shuaibin Liu et al.
Oncotarget, 7(46), 75468-75481 (2016-10-01)
Cervical cancer is one of the most common malignant tumor in women. The mechanisms of cervical cancer are intricate and have not been fully understood. Therefore, we employed iTRAQ to obtain novel proteins profile which participates in the tumor oncogenesis
Xiaoyun Wang et al.
Scientific reports, 7, 42675-42675 (2017-02-17)
Hypersecretion of mucus is an important component of airway remodeling and contributes to the mucus plugs and airflow obstruction associated with severe asthma phenotypes. Lyn has been shown to down-regulate allergen-induced airway inflammation. However, the role of Lyn in mucin
Lei Meng et al.
Acta biochimica et biophysica Sinica, 52(1), 49-57 (2019-12-13)
Gastric cancer (GC) is one of malignant tumors with high mortality and morbidity in the world. MicroRNA-122 (miR-122) acts as a tumor suppressor in a variety of cancers and has been found to be dominant in gastric adenocarcinoma. However, the
D Thaper et al.
Oncogene, 36(28), 3964-3975 (2017-03-14)
The acquisition of an invasive phenotype by epithelial cells occurs through a loss of cellular adhesion and polarity, heralding a multistep process that leads to metastatic dissemination. Since its characterization in 1995, epithelial-mesenchymal transition (EMT) has been closely linked to
Pradip Das et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 181-192 (2020-12-06)
MCP-1-induced monocyte chemotaxis is a crucial event in inflammation and atherogenesis. Identifying the important signal transduction pathways that control monocyte chemotaxis can unravel potential targets for preventive therapies in inflammatory disease conditions. Previous studies have shown that the focal adhesion
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico