Transfection protocols vary from transfection reagent and cell line. Transfect the cell line of interest with esiRNA following the manufacturer’s instructions for the transfection reagent. esiRNA should be tested in a pilot experiment to validate the best concentration and experimental procedure to use with every cell line. Known transfection conditions used for chemically synthesized siRNA are a good starting point for optimization.
EHU087051
MISSION® esiRNA
targeting human MVP
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Seleccione un Tamaño
20 μG
US$ 534,00
50 μG
US$ 953,00
US$ 534,00
PRECIOS SIN IMPUESTOS NACIONALES
Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Seleccione un Tamaño
Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00
About This Item
Código UNSPSC:
41105324
NACRES:
NA.51
US$ 534,00
PRECIOS SIN IMPUESTOS NACIONALES
Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Productos recomendados
descripción
Powered by Eupheria Biotech
Nivel de calidad
Línea del producto
MISSION®
Formulario
lyophilized powder
secuencia objetivo ADNc esiRNA
AAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCG
Ensembl | nº de acceso humano
Nº de acceso NCBI
Condiciones de envío
ambient
temp. de almacenamiento
−20°C
Descripción general
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Información legal
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de clase de almacenamiento
10 - Combustible liquids
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Elija entre una de las versiones más recientes:
Certificados de análisis (COA)
Lot/Batch Number
¿No ve la versión correcta?
Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Hyun Min Lee et al.
Scientific reports, 7(1), 13201-13201 (2017-10-19)
Circulating tumor cells (CTCs) play a major role in the metastasis and recurrence of hepatocellular carcinoma (HCC). Here, we found that major vault protein (MVP) is expressed on the surface of HCC cells and further induced under stressful environments. MVP
Shi Liu et al.
Journal of hepatology, 62(5), 1015-1023 (2014-12-08)
We previously demonstrated that major vault protein (MVP) is a novel virus-induced host factor and its expression upregulates type-I interferon production, leading to cellular antiviral response. However, it remains unclear whether the antiviral function of MVP is impaired during hepatitis
-
How long should I transfect cells with this product?
1 answer-
Helpful?
-
Active Filters
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico
