Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU085901

Sigma-Aldrich

MISSION® esiRNA

targeting human GLS (2)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGAAAAGAGCCGAGTGGACTAAGATTCAACAAACTATTTTTGAATGAAGATGATAAACCACATAATCCTATGGTAAATGCTGGAGCAATTGTTGTGACTTCACTAATAAAGCAAGGAGTAAATAATGCTGAAAAATTTGACTATGTCATGCAGTTTTTGAATAAGATGGCTGGTAATGAATATGTTGGATTCAGTAATGCAACGTTTCAGTCTGAAAGAGAAAGTGGAGATCGAAATTTTGCAATAGGATATTACTTAAAAGAAAAGAAGTGTTTTCCAGAAGGCACAGACATGGTTGGTATATTAGACTTCTACTTCCAGCTGTGCTCCATTGAAGTGACTTGTGAATCAGCCAGTGTGATGGCTGCGACACTGGCTAATGGTGGTTTCTGCCCAATTACTGGTGAAAGAGTACTGAGCCCTGAAGCAGTTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jae-Seon Lee et al.
Biochemical and biophysical research communications, 477(3), 374-382 (2016-06-25)
We found that non-small cell lung cancer (NSCLC) is remarkably sensitive to the regulation of glutamine supply by testing the metabolic dependency of 11 cancer cell lines against regulation of glycolysis, autophagy, fatty acid synthesis, and glutamine supply. Glutamine is
Denis A Mogilenko et al.
Cell, 177(5), 1201-1216 (2019-04-30)
Innate immune responses are intricately linked with intracellular metabolism of myeloid cells. Toll-like receptor (TLR) stimulation shifts intracellular metabolism toward glycolysis, while anti-inflammatory signals depend on enhanced mitochondrial respiration. How exogenous metabolic signals affect the immune response is unknown. We
Xuan Qu et al.
Biochemical and biophysical research communications, 504(2), 415-421 (2018-08-15)
Oncogenic c-Myc-induced metabolic reprogramming triggers cellular dependency on exogenous glucose and glutamine. Understanding how nutrients are used may provide new target for therapeutic intervention. We previously provided an alternate route to c-Myc-driven glucose metabolism via the repression of thioredoxin-interacting protein
Lisha Xiang et al.
Cell death & disease, 10(2), 40-40 (2019-01-25)
Cancer cells re-program their metabolic machinery to meet the requirements of malignant transformation and progression. Glutaminase 1 (GLS1) was traditionally known as a mitochondrial enzyme that hydrolyzes glutamine into glutamate and fuels rapid proliferation of cancer cells. However, emerging evidence
Yuta Mizuno et al.
Oncology letters, 19(4), 2934-2942 (2020-03-29)
The high expression of metabolic enzymes, including glutaminase (GA) and lactate dehydrogenase A (LDHA), which contribute to bioenergetics and biosynthesis of mammalian cells, has been identified in a variety of cancer types. The current study indicated intratumoral heterogeneity with respect

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico