Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU084891

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC8A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGGCCCTTACCATTATCCGCAGAGGTGGTGATTTGACTAACACTGTGTTTGTTGACTTCAGAACAGAGGATGGCACAGCAAATGCTGGGTCTGATTATGAATTTACTGAAGGAACTGTGGTGTTTAAGCCTGGTGATACCCAGAAGGAAATCAGAGTGGGTATCATAGATGATGATATCTTTGAGGAGGATGAAAATTTCCTTGTGCATCTCAGCAATGTCAAAGTATCTTCTGAAGCTTCAGAAGATGGCATACTGGAAGCCAATCATGTTTCTACACTTGCTTGCCTCGGATCTCCCTCCACTGCCACTGTAACTATTTTTGATGATGACCACGCAGGCATTTTTACTTTTGAGGAACCTGTGACTCATGTGAGTGAGAGCATTGGCATCATGGAGGTGAAAGTATTGAGAACATCTGGAGCTCGAGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guendalina Bastioli et al.
Cell death & disease, 10(2), 80-80 (2019-01-30)
Progressive accumulation of α-synuclein (α-syn) and exposure to environmental toxins are risk factors that may both concur to Parkinson's disease (PD) pathogenesis. Electrophysiological recordings of field postsynaptic potentials (fEPSPs) and Ca2+ measures in striatal brain slices and differentiated SH-SY5Y cells
Barbora Chovancova et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 763-777 (2017-11-24)
Melatonin is a hormone transferring information about duration of darkness to the organism and is known to modulate several signaling pathways in the cells, e.g. generation of endoplasmic reticulum stress, oxidative status of the cells, etc. Melatonin has been shown
Silvia Piccirillo et al.
Cell death & disease, 9(7), 731-731 (2018-06-30)
In brain ischemia, reduction in oxygen and substrates affects mitochondrial respiratory chain and aerobic metabolism, culminating in ATP production impairment, ionic imbalance, and cell death. The restoration of blood flow and reoxygenation are frequently associated with exacerbation of tissue injury
M Song et al.
British journal of pharmacology, 171(14), 3432-3447 (2014-03-20)
SKF 96365 is well known for its suppressing effect on human glioblastoma growth by inhibiting pre-activated transient receptor potential canonical (TRPC) channels and Ca(2+) influx. The effect of SKF 96363 on glioblastoma cells, however, may be multifaceted and this possibility

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico