Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU083721

Sigma-Aldrich

MISSION® esiRNA

targeting human POMT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCAGAACCTCTGGAGACTGGAAATTGTGAACAGAGGATCTGACACAGACGTCTGGAAGACCATCCTCTCAGAGGTCCGCTTTGTGCACGTGAACACTTCCGCTGTCTTAAAGCTGAGCGGGGCTCACCTCCCTGACTGGGGGTATCGGCAACTGGAGATCGTCGGGGAGAAGCTGTCCCGGGGCTACCACGGGAGCACGGTGTGGAACGTGGAGGAGCACCGATACGGCGCGAGCCAGGAGCAGAGGGAGCGGGAACGGGAGCTGCACTCACCTGCGCAGGTGGACGTCAGCAGGAACCTCAGCTTCATGGCGAGATTCTCGGAGCTGCAGTGGAGGATGCTGGCGCTGAGAAGTGATGACTCGGAACACAAGTACAGCTCCAGCCCACTGGAGTGGGTCACCCTGGACACCAATATTGCCTACTGGCTGCACC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gene-Errol E Ringpis et al.
PloS one, 7(12), e53492-e53492 (2013-01-10)
Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT) mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC) transplant and immune system reconstitution as well
Julie Martone et al.
EMBO reports, 21(6), e49942-e49942 (2020-04-28)
Guanine-quadruplexes (G4) included in RNA molecules exert several functions in controlling gene expression at post-transcriptional level; however, the molecular mechanisms of G4-mediated regulation are still poorly understood. Here, we describe a regulatory circuitry operating in the early phases of murine

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico