Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU083661

Sigma-Aldrich

MISSION® esiRNA

targeting human WT1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAGGGCATGTGTATGTGTCTGCTAATGTAAACTTTGTCATGGTTTCCATTTACTAACAGCAACAGCAAGAAATAAATCAGAGAGCAAGGCATCGGGGGTGAATCTTGTCTAACATTCCCGAGGTCAGCCAGGCTGCTAACCTGGAAAGCAGGATGTAGTTCTGCCAGGCAACTTTTAAAGCTCATGCATTTCAAGCAGCTGAAGAAAAAATCAGAACTAACCAGTACCTCTGTATAGAAATCTAAAAGAATTTTACCATTCAGTTAATTCAATGTGAACACTGGCACACTGCTCTTAAGAAACTATGAAGATCTGAGATTTTTTTGTGTATGTTTTTGACTCTTTTGAGTGGTAATCATATGTGTCTTTATAGATGTACATACCTCCTTGCACAAATGGAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xue Wang et al.
Theriogenology, 148, 8-17 (2020-03-04)
To determine the role of 3, 3', 5-triiodo-L thyroxine (T3) in the differentiation of Sertoli cells (SCs) and the factors influencing maturity via the Wilms' tumor 1 (WT1)/non-canonical Wnt signaling pathway, high purity SCs were isolated from newborn calves' testes
Junjie Chen et al.
Journal of experimental & clinical cancer research : CR, 35(1), 173-173 (2016-11-09)
The metastatic cascade is a complex and multistep process with many potential barriers. Recently, miR-193a has been reported to be a suppressive miRNA in multiple types of cancers, but its underlying anti-oncogenic activity in non-small cell lung cancers (NSCLC) is
Tove Ullmark et al.
Biochemical and biophysical research communications, 482(4), 802-807 (2016-11-28)
Wilms' tumor gene 1 (WT1) is a zinc finger transcription factor that has been implicated as an oncogene in leukemia and several other malignancies. When investigating possible gene expression network partners of WT1 in a large acute myeloid leukemia (AML)
Xue Wang et al.
Reproduction, fertility, and development, 32(5), 522-530 (2020-02-06)
The gap junction protein connexin (Cx) 43 between adjacent Sertoli cells (SCs) is the main testicular factor regulating the growth and development of SCs, and plays a vital role in controlling cell differentiation and maturation. However, the endogenous testicular factors
Paramahamsa Maturu et al.
Neoplasia (New York, N.Y.), 19(3), 237-249 (2017-03-04)
Wilms' tumors (WT), which accountfor 6% of all childhood cancers, arise from dysregulated differentiation of nephrogenic progenitor cells from embryonic kidneys. Though there is an improvement in the prognosis of WT, still 10% of patients with WT die due to

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico