Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU081471

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1I2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRICE WITHOUT NATIONAL TAXES
Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRICE WITHOUT NATIONAL TAXES
Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTGTCTCTGCATCCATTTGAACACATTATTAAGCACCGATAATAGGTAGCCTGCTGTGGGGTATACAGCATTGACTCAGATATAGATCCTGAGCTCACAGAGTTTATAGTTAAAAAAACAAACAGAAACACAAACGATTTGGATCAAAAGGAGAAATGATAAGTGACAAAAGCAGCACAAGGAATTTCCCTGTGTGGATGCTGAGCTGTGATGGCGGGCACTGGGTACCCAAGTGAAGGTTCCCAAGGACATGAGTCTGTAGGAGCAAGGGCACAAACTGCAGCTGTGAGTGCGTGTGTGTGATTTGGTGTAGGTAGGTCTGTTTGCCACTTGATGGGGCCTGGGTTTGTTCCTGGGGCTGGAATGCTGGGTATGCTCTGTGACAAGGCTACGCTGACAATCA

Ensembl | nº de acceso humano

ENSG00000144852

Nº de acceso NCBI

NM_022002

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... NR1I2(8856) , NR1I2(8856)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenjing Luo et al.
British journal of pharmacology, 174(8), 700-717 (2017-01-28)
Imatinib mesylate (IM) is a first-line treatment for chronic myeloid leukaemia (CML) as a specific inhibitor of BCR-ABL tyrosine kinase. As IM is widely used in CML, in combination with other drugs, the effects of IM on drug-metabolizing enzymes (DMEs)
M Semeniuk et al.
Archives of toxicology, 94(5), 1625-1635 (2020-03-19)
P-glycoprotein (P-gp) is an ABC transporter exhibiting high pharmacotoxicological relevance by extruding a wide range of cytotoxic compounds out of the cells. Previously, we demonstrated that the phytoestrogen genistein (GNT) modulates P-gp expression in hepatocellular carcinoma in vitro. Although several
Yan Chen et al.
Cancer medicine, 5(12), 3564-3571 (2016-11-24)
Cytochrome P450 2C8 (CYP2C8) is one of the enzymes that primarily participate in producing metabolisms of medications and P-glycoprotein (P-gp) has been regarded as one of the important molecules in chemotherapeutically induced multidrug resistance (MDR). In addition, the pregnane X
Yiqiang Xie et al.
Pakistan journal of pharmaceutical sciences, 31(5(Special)), 2315-2321 (2018-11-23)
Feng-Liao-Chang-Wei-Kang (FLCWK), a traditional Chinese patent medicine, consists primarily of Polygonum hydropiper and Daphniphyllum calycinum roots. As a complex containing several kinds of flavonoids, FLCWK has the potential to impact the drug metabolism enzyme P450 3A4 (CYP3A4) and nuclear receptors.
Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico