Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU080501

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGAP4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGGAGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCCCTGGTGGTGGAGAGCTGCATTCGCTTCATCAACCTCAATGGCC

Ensembl | human accession no.

ENSG00000089820

NCBI accession no.

NM_001666

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ARHGAP4(393) , ARHGAP4(393)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dabin Lee et al.
Cell death & disease, 9(5), 495-495 (2018-05-03)
Chemokine CCL4 (MIP-1β) is released from osteoblast cells to restore the homeostasis of hematopoietic stem cells during the activation of bone marrow. In this study, we investigated the function of CCL4 and its receptor CCR5 during osteoclastogenesis. CCL4 promoted the
P-S Hu et al.
Oncogene, 36(33), 4706-4718 (2017-04-11)
Polycomb group (PcG) proteins play an important role in development and stem cell maintenance, and their dysregulation have been closely linked to oncogenesis and cancer stem cell phenotypes. Here, we found that nervous system polycomb 1 (NSPc1) was highly expressed
Y-B Yu et al.
Acta physiologica (Oxford, England), 219(2), 465-477 (2016-05-28)
Erythropoietin (EPO), the key hormone involved in erythropoiesis, beneficially affects endothelial cells (ECs), but the detailed mechanisms are yet to be completely understood. In this study, we investigated the role of transient receptor potential vanilloid type 1 (TRPV1), a ligand-gated
Yehua Shen et al.
OncoTargets and therapy, 12, 5003-5012 (2019-07-16)
The phenomenon that cancer cells avidly exhibit glycolysis with lactate secretion and decrease in mitochondrial activity under aerobic conditions is known historically as the Warburg effect. Rho GTPase-activating protein 4 (ARHGAP4) is an important negative regulator of the Rho signaling
Suresh Govatati et al.
Arteriosclerosis, thrombosis, and vascular biology, 40(5), 1256-1274 (2020-03-13)
In view of our previous observations on differential expression of LMCD1 (LIM and cysteine-rich domains 1) in human versus rodents, we asked the question whether LMCD1 plays a species-specific role in the development of vascular lesions. Approach and Results: A
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico