Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU079251

Sigma-Aldrich

MISSION® esiRNA

targeting human AIFM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAAAAGCAACTGCACAAGACAACCCCAAATCTGCCACAGAGCAGTCAGGAACTGGTATCCGATCAGAGAGTGAGACAGAGTCCGAGGCCTCAGAAATTACTATTCCTCCCAGCACCCCGGCAGTTCCACAGGCTCCCGTCCAGGGGGAGGACTACGGCAAAGGTGTCATCTTCTACCTCAGGGACAAAGTGGTCGTGGGGATTGTGCTATGGAACATCTTTAACCGAATGCCAATAGCAAGGAAGATCATTAAGGACGGTGAGCAGCATGAAGATCTCAATGAAGTAGCCAAACTATTCAACATTCATGAAGACTGAAGCCCCACAGTGGAATTGGCAAACCCACTGCAGCCCCTGAGAGGAGGTCGAATGGGTAAAGGAGCATTTTTTTATTCAGCAGACTTTCTCTGTGTATGAGTGTGAATGATCAAGTCCTTTGTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mausumi Basu et al.
PLoS pathogens, 13(2), e1006240-e1006240 (2017-02-28)
Oxidative stress activates the cellular kinase HRI, which then phosphorylates eIF2α, resulting in stalled translation initiation and the formation of stress granules (SGs). SG assembly redirects cellular translation to stress response mRNAs and inhibits cap-dependent viral RNA translation. Flavivirus infections
Hongwei Zhao et al.
Cancer letters, 374(1), 136-148 (2016-02-09)
Programmed necrosis is established as a new form of programmed cell death and is emerging as a new strategy of treatment for cancers. Pristimerin is a natural chemical with anti-tumor effect despite the fact that its mechanism remains poorly understood.
Chongcheng Wang et al.
Cell death & disease, 11(8), 630-630 (2020-08-18)
Induction of lethal autophagy has become a strategy to eliminate glioma cells, but it remains elusive whether autophagy contributes to cell death via causing mitochondria damage and nuclear translocation of apoptosis inducing factor (AIF). In this study, we find that
Nan Zhao et al.
Oncotarget, 6(21), 18445-18459 (2015-06-20)
Here we demonstrated that sepantronium bromide (YM155), a survivin suppressant, inhibited esophageal squamous-cell carcinoma (ESCC) growth in mice bearing human ESCC xenografts without affecting body weight. In cell culture, YM155 decreased survivin levels and caused PARP-1 activation, poly-ADP polymer formation

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico