Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU077821

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB20

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGACTTTCACCGCCAAACAGAACTACGTCAAGCACATGTTCGTACACACAGGTGAGAAGCCCCACCAATGCAGCATCTGTTGGCGCTCCTTCTCCTTAAAGGATTACCTTATCAAGCACATGGTGACACACACAGGAGTGAGGGCATACCAGTGTAGTATCTGCAACAAGCGCTTCACCCAGAAGAGCTCCCTCAACGTGCACATGCGCCTCCACCGGGGAGAGAAGTCCTACGAGTGCTACATCTGCAAAAAGAAGTTCTCTCACAAGACCCTCCTGGAGCGACACGTGGCCCTGCACAGTGCCAGCAATGGGACCCCCCCTGCAGGCACACCCCCAGGTGCCCGCGCTGGCCCCCCAGGCGTGGTGGCCTGCACGGAGGGGACCACTTACGTCTGCTCCGTCTGCCCAGCAAAGTTTGACCAAATCGAGCAGTTCAACGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

An-Jing Ren et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(10), 13862-13876 (2020-08-28)
The zinc-finger protein ZBTB20 regulates development and metabolism in multiple systems, and is essential for postnatal survival in mice. However, its potential role in the cardiovascular system remains undefined. Here, we demonstrate that ZBTB20 is critically involved in the regulation
Liuyang Wang et al.
Cell host & microbe, 24(2), 308-323 (2018-08-10)
Pathogens have been a strong driving force for natural selection. Therefore, understanding how human genetic differences impact infection-related cellular traits can mechanistically link genetic variation to disease susceptibility. Here we report the Hi-HOST Phenome Project (H2P2): a catalog of cellular
Ji Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(5), 2074-2083 (2018-08-14)
To determine the cellular functions and clinical significance of micro-758-5p (miR-758-5p) in glioblastoma (GBM) by targeting zinc finger and BTB domain-containing protein 20 (ZBTB20). Fifty-five paired GBM tissues and adjacent normal tissues, GBM cell lines (U118, LN-299, H4, A172, U87-MG

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico