Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU075161

Sigma-Aldrich

MISSION® esiRNA

targeting human SETD2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAGGAAAGGGATTTGCTTCCAGGGAGAACAGGCGTAATAATGGGTTATCTGGGAAATGTTTGCAAGAGGCTCAAGAAGAAGGGAATTCCATATTGCCTGAAAGAAGAGGAAGACCAGAAATCTCTTTAGATGAAAGAGGAGAAGGAGGACATGTGCATACTTCTGATGACTCAGAAGTTGTATTTTCTTCTTGTGATTTGAATTTAACCATGGAAGACAGTGATGGTGTAACTTATGCATTAAAGTGTGACAGTAGTGGTCATGCCCCAGAAATTGTGTCTACAGTTCATGAAGATTATTCTGGCTCTTCTGAAAGTTCAAATGATGAAAGTGATTCAGAAGATACAGATTCGGATGATAGCAGTATTCCAAGAAACCGTCTCCAGTCTGTTGTGGTTGTGCCAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

You Zhou et al.
Aging, 12(24), 25189-25206 (2020-11-24)
The histone H3 lysine 36 methyltransferase SET-domain-containing 2 (SETD2) has been reported to be frequently mutated or deleted in many types of human cancer. However, the role of SETD2 in lung adenocarcinoma (LUAD) has not been well documented. In the
Sergej Pirkmajer et al.
Frontiers in physiology, 11, 566584-566584 (2020-10-27)
The cardiotonic steroids (CTS), such as ouabain and marinobufagenin, are thought to be adrenocortical hormones secreted during exercise and the stress response. The catalytic α-subunit of Na,K-ATPase (NKA) is a CTS receptor, whose largest pool is located in skeletal muscles
A Rolfo et al.
Cell death & disease, 3, e305-e305 (2012-05-04)
The E3 ubiquitin ligase MULE (Mcl-1 Ubiquitin Ligases E3) targets myeloid cell leukemia factor 1 (Mcl-1) and tumor suppressor p53 for proteasomal degradation. Although Mcl-1 and p53 have been implicated in trophoblast cell death in preeclampsia (PE) and intrauterine growth
Na Liu et al.
Oncology reports, 32(6), 2397-2404 (2014-10-22)
Previously, we reported that hypoxia was able to induce invasion and metastasis in gastric cancer and that hypoxia-inducible factor-1 (HIF-1) is a key factor involved in this tumor type. Krüppel-like factor 8 (KLF8) as a transcriptional repressor has been suggested

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico