Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU074811

Sigma-Aldrich

MISSION® esiRNA

targeting human WHRN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGAGGCCTTCAAGACTAAGGACCGTGACTACATTGACTTTCTGGTCACTGAGTTCAATGTGATGCTCTAGAGGCCAAGGCCTGAGGGCCTCCCACCACTGCCCAGCCCCTGGTCCCAGTCCCTTTCCACCGTTGGCTTCATCAAGCTCCTTGCGGGGTTGGGGCTGCATGGCCAGGGTGGCAGGAAGACATCCCCCCTCCATCCCAGCCCACTGGACCAGAACTGGGAGAGGAAGAGAGCAGGACAAGGCAGACAGAAGGTCAGGTCAGGAACTGGTGCTGTACTGGGTACACAGTAGGCGCCCAGGACAAGTGGGTTGCAAGACAGGAAGAAAGGAAAAGGAAGGGCAGAGTGCTGGTTTCTCCAGGTTGGGTTGGGGGCACTGCTGTCCCCCCTCCAGCTAGGACCCAGCCCATCCCCAGATGCCTGAGCCTTTGTCCAAAGTGA

Ensembl | nº de acceso humano

ENSG00000095397

Nº de acceso NCBI

NM_001083885

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... WHRN(25861) , DFNB31(25861)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fernanda C Teixeira et al.
Pharmaceutical development and technology, 25(4), 408-415 (2019-12-19)
Introduction: Glioblastoma (GB) is the most common malignant brain tumor and is characterized by high invasiveness, poor prognosis, and limited therapeutic options. Silencing gene expression, through the use of small interfering RNA (siRNA), has been proposed as an alternative to
Wuming Gong et al.
BMC bioinformatics, 7, 516-516 (2006-11-30)
Short interfering RNAs have allowed the development of clean and easily regulated methods for disruption of gene expression. However, while these methods continue to grow in popularity, designing effective siRNA experiments can be challenging. The various existing siRNA design guidelines
Avraam El Hamidieh et al.
PloS one, 7(8), e42722-e42722 (2012-08-23)
Cdc37 is a 50 kDa molecular chaperone which targets intrinsically unstable protein kinases to the molecular chaperone HSP90. It is also an over-expressed oncoprotein that mediates carcinogenesis and maintenance of the malignant phenotype by stabilizing the compromised structures of mutant
Shun Yao et al.
Cancer letters, 502, 1-8 (2020-12-07)
Angio-associated migratory cell protein (AAMP) is considered a pro-tumor protein, which contributes to angiogenesis, proliferation, adhesion, and other biological activities. Although AAMP is known to facilitate the motility of breast cancer cells and smooth muscle cells by regulating ras homolog
Ya-Jie Zhang et al.
World journal of gastroenterology, 20(25), 8229-8236 (2014-07-11)
To investigate the effect of Girdin knockdown on the chemosensitivity of colorectal cancer cells to oxaliplatin and the possible mechanisms involved. Four siRNAs targeting Girdin were transfected into the chemoresistant colorectal cancer cell line DLD1. Real-time polymerase chain reaction (PCR)

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico