Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU074341

Sigma-Aldrich

MISSION® esiRNA

targeting human OXA1L

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGTGGGCTGTTCTTGAGCTAGGTGCTGAGACAGGTGTGCAAAGTTCTGACCTTCAGTGGATGAGAAATGTCATCAGAATGATGCCCCTGATAACCTTGCCCATAACCATGCATTTCCCCACGGCAGTGTTTATGTACTGGCTCTCCTCCAATTTGTTTTCCCTGGTCCAAGTATCCTGTCTCCGGATTCCAGCAGTACGCACTGTACTTAAAATCCCCCAGCGTGTTGTACATGACCTGGACAAATTACCTCCACGGGAAGGCTTCCTAGAGAGCTTCAAAAAAGGCTGGAAAAATGCTGAAATGACGCGTCAGCTGCGAGAGCGTGAACAACGCATGCGGAATCAGTTGGAGCTAGCAGCCAGGGGTCCTTTACGACAGACCTTTACCCACAACCCTCTCCTACAACCTGGAAAGGATAACCCTCCCAATATCCCTAGCAGCAGC

Ensembl | human accession no.

ENSG00000155463

NCBI accession no.

NM_005015

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... OXA1L(5018) , OXA1L(5018)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
TVT
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongfei Chen et al.
Bioengineered, 11(1), 1269-1279 (2020-11-04)
Emerging evidence suggested that circular RNAs (circRNAs) play critical roles in cervical cancer (CC) progression. However, the roles and molecular mechanisms of hsa_circ_0007364 in the tumorigenesis of CC remain unclear. In the present study, we used bioinformatics analysis and a
Yuhan Chen et al.
Gene, 629, 35-42 (2017-08-05)
Radiation-induced liver fibrosis (RILF) is considered as a major complication of radiation therapy for liver cancer. Circular RNA (circRNA) has been recently identified as a functional noncoding RNA involving in various biological processes. However, the expression pattern and regulatory capacity
Beibei Shao et al.
Biochemical and biophysical research communications, 513(1), 135-140 (2019-04-05)
Recent studies indicated that circular RNAs (circRNAs) could play critical roles in the initiation and development of tumors, including tongue squamous cell carcinoma (TSCC). We aimed to investigate the roles and underlying mechanisms of hsa_circ_0001742 in TSCC. In the present
Wei Liu et al.
Biochemical and biophysical research communications, 500(4), 846-851 (2018-04-27)
Lung cancer characterized with malignant cell growth is the leading cause of cancer-related deaths. In recent years, several circular RNAs (circRNAs) have been reported to participate in lung cancer progression. However, the correlation between circular RNA (circRNA) and lung cancer still
Shujun Wu et al.
Biological chemistry, 399(12), 1457-1467 (2018-08-24)
As the most common histological subtype of lung cancer, lung adenocarcinoma remains a tremendous risk to public health, which requires ceaseless efforts to elucidate the potential diagnostic and therapeutic strategies. Circular RNAs (circRNAs) have been identified with emerging roles in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico