Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU073331

Sigma-Aldrich

MISSION® esiRNA

targeting human DNM3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGACAGGAATCTCCTCAGAATGAAGAATAAAGCCTACTAGGTCTCTAACTGTTGAACTCATGAAAGAAGATAGTGTATGAGACTTAAGCCATGAGTTTTGTATCATTTCAATTAGAAGACTACTAGCTGTGAGCTCAGAGTTTAATGTAAATGAATCTAGATGATTTTGAAGAAATGATTATTCGTTCACCAGATCACTCATTGTACATTCTAAAAAGCTCAAATGAGTCTTCTAGATACTCTTACTCATCCTGTCTGGTTGCTATGTTTAAAATTATGTGGTGCTGTGTAGGTGAAACTTTAAGAATATTTTTGAAGCATATGTAATATATGCACTGCTATTTGTGTGTGTGTGTGTGTCTTTGTATATATGTAAGAATGTGTGTATGTGTGAGAGCAAGAGAGAGGA

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bin Sheng Wong et al.
Cancer research, 79(11), 2878-2891 (2019-04-13)
The sialoglycoprotein podocalyxin is absent in normal pancreas but is overexpressed in pancreatic cancer and is associated with poor clinical outcome. Here, we investigate the role of podocalyxin in migration and metastasis of pancreatic adenocarcinomas using SW1990 and Pa03c as
Chao Gu et al.
Oncology letters, 13(6), 4776-4784 (2017-06-11)
Dynamin 3 (DNM3) is candidate tumor suppressor against hepatocellular carcinoma (HCC). Downregulation of DNM3 is more frequently identified in HCC tissues than in normal liver tissues. However, the mechanism underlying DNM3-mediated inhibition of HCC remains unclear. The present study demonstrated

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico