Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU072911

Sigma-Aldrich

MISSION® esiRNA

MISSION® esiRNA

targeting human FOSL2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCTGGGGATTCAGCTCTAGAGGTCACAGTATCCTCGTTTGAAAGATAATTAAGATCCCCCGTGGAGAAAGCAGTGACACATTCACACAGCTGTTCCCTCGCATGTTATTTCATGAACATGACCTGTTTTCGTGCACTAGACACACAGAGTGGAACAGCCGTATGCTTAAAGTACATGGGCCAGTGGGACTGGAAGTGACCTGTACAAGTGATGCAGAAAGGAGGGTTTCAAAGAAAAAGGATTTTGTTTAAAATACTTTAAAAATGTTATTTCCTGCATCCCTTGGCTGTGATGCCCCTCTCCCGATTTCCCAGGGGCTCTGGGAGGGACCCTTCTAAGAAGATTGGGCAGTTGGGTTTCTGGCTTGAGATGAATCCAAGCAGCAGAATGAGCCAGGAGTAGCAGGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lan Ling et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 104, 411-419 (2018-05-23)
Hepatocyte proliferation and apoptosis are critical cellular behaviors in rat liver as a result of a liver injury. Herein, we performed this study in order to evaluate the role of miR-30e and its target Fos-Related Antigen-2 (FOSL2) in septic rats
Shuo Li et al.
Experimental cell research, 373(1-2), 57-61 (2018-08-17)
Among different cancers, incidence and mortality of colorectal cancer (CRC) is one of the highest. KRAS mutation is one of the underlying features in the pathogenesis of CRC with CRC tumors harboring mutant KRAS exhibiting a more aggressive behavior compared
Poonam Sarode et al.
Science advances, 6(23), eaaz6105-eaaz6105 (2020-06-18)
Tumor-associated macrophages (TAMs) influence lung tumor development by inducing immunosuppression. Transcriptome analysis of TAMs isolated from human lung tumor tissues revealed an up-regulation of the Wnt/β-catenin pathway. These findings were reproduced in a newly developed in vitro "trained" TAM model.
Keito Okazaki et al.
Nature communications, 11(1), 5911-5911 (2020-11-22)
Transcriptional dysregulation, which can be caused by genetic and epigenetic alterations, is a fundamental feature of many cancers. A key cytoprotective transcriptional activator, NRF2, is often aberrantly activated in non-small cell lung cancers (NSCLCs) and supports both aggressive tumorigenesis and
Jon M Carthy et al.
Journal of cellular physiology, 230(12), 3084-3092 (2015-06-23)
Transforming growth factor-β (TGF-β) is a multifunctional cytokine which stimulates the differentiation of fibroblasts into myofibroblasts. Myofibroblasts are critical for normal wound healing, but also accumulate pathologically in a number of chronic inflammatory conditions where they are key contributors to

Questions

Reviews

Active Filters

  1. 1 Ratings-Only Review

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico