Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU071261

Sigma-Aldrich

MISSION® esiRNA

targeting human PDPK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGTGTCTTCGTCCTCCTCCTCACACTCCCTGTCAGCCTCCGACACGGGCCTGCCCCAGAGGTCAGGCAGCAACATAGAGCAGTACATTCACGATCTGGACTCGAACTCCTTTGAACTGGACTTACAGTTTTCCGAAGATGAGAAGAGGTTGTTGTTGGAGAAGCAGGCTGGCGGAAACCCTTGGCACCAGTTTGTAGAAAATAATTTAATACTAAAGATGGGCCCAGTGGATAAGCGGAAGGGTTTATTTGCAAGACGACGACAGCTGTTGCTCACAGAAGGACCACATTTATATTATGTGGATCCTGTCAACAAAGTTCTGAAAGGTGAAATTCCTTGGTCACAAGAACTTCGACCAGAGGCCAAGAATTTTAAAACTTTCTTTGTCCACACGCCTAACAGGACGTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tingting Hu et al.
BioMed research international, 2020, 4351671-4351671 (2020-02-07)
Cervical cancer is one of the malignant tumors that seriously threaten women's health. The mechanism of development needs to be deeply studied. In recent years, lncRNA has been identified as one of the important factors affecting the malignant progression of
Zheng Tan et al.
Journal of immunology (Baltimore, Md. : 1950), 194(12), 6082-6089 (2015-05-13)
The M1 and M2 polarized phenotypes dictate distinctive roles for macrophages as they participate in inflammatory disorders. There has been growing interest in the role of cellular metabolism in macrophage polarization. However, it is currently unclear whether different aspects of

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico