Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU068301

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTACCACCTTGGGGTGAGAGAAAGTTTCAGCATGGCCAACAACATCATCCTCTACTGTGATACTAACTCGGACTCTCTGCAGTCACTGAAGGAAATAATTTGCCAGAAGAATACTATGTGCACTGGGAACTACACCTTTGTTCCTTACATGATAACTCCACATAACAAAGTCTACTGCTGTGACAGCAGCTTCATGAAGGGGTTGACAGAGCTCATGCAACCGAACTTCGAGCTGCTTCTTGGACCCATCTGCTTACCTCTTGTGGATCGTTTTATTCAACTTTTGAAGGTGGCACAAGCAAGTTCTAGCCAGTACTTCCGGGAATCTATACTCAATGACATCAGGAAAGCTCGTAATTTATACACTGGTAAAGAATTGGCAGCTGAGTTGGCAAGAATTCGGCAGCGAGTAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yongwei Yao et al.
Biochemical and biophysical research communications, 493(3), 1288-1295 (2017-10-03)
Interleukin-33 (IL-33), a new member of the IL-1 cytokine family, has cardiac protective effect in many circumstances. The aims of present study are to assess whether IL-33 can protect cardiomyocytes from doxorubicin (DOX)-induced apoptosis and the mechanism involved in the
Liwei Ma et al.
Journal of experimental & clinical cancer research : CR, 38(1), 77-77 (2019-02-15)
Metformin, a first-line drug for type 2 diabetes, could induce apoptosis in cancer cells. However, the concentration of glucose affects the effect of metformin, especially low glucose in the culture medium can enhance the cytotoxicity of metformin on cancer cells.
Mathew S Eapen et al.
Clinical science (London, England : 1979), 132(14), 1615-1627 (2018-07-15)
Increased airway smooth muscle (ASM) mass is observed in chronic obstructive pulmonary disease (COPD), which is correlated with disease severity and negatively affects lung function in these patients. Thus, there is clear unmet clinical need for finding new therapies which
Chiara Imarisio et al.
Free radical biology & medicine, 112, 141-148 (2017-07-26)
Steatosis intensifies hepatic ischemia/reperfusion (I/R) injury increasing hepatocyte damage and hepatic inflammation. This study evaluates if this process is associated to a differential response of steatotic hepatocytes (HP) and Kupffer cells (KC) to I/R injury and investigates the molecular mechanisms
Musarat Ishaq et al.
Biochimica et biophysica acta, 1843(12), 2827-2837 (2014-09-01)
Atmospheric pressure gas plasma (AGP) generates reactive oxygen species (ROS) that induce apoptosis in cultured cancer cells. The majority of cancer cells develop a ROS-scavenging anti-oxidant system regulated by Nrf2, which confers resistance to ROS-mediated cancer cell death. Generation of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico