Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU068071

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC8A3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACCGCTTCATGGCATCTATTGAAGTCATCACCTCTCAAGAGAGGGAGGTGACAATTAAGAAACCCAATGGAGAAACCAGCACAACCACTATTCGGGTCTGGAATGAAACTGTCTCCAACCTGACCCTTATGGCCCTGGGTTCCTCTGCTCCTGAGATACTCCTCTCTTTAATTGAGGTGTGTGGTCATGGGTTCATTGCTGGTGATCTGGGACCTTCTACCATTGTAGGGAGTGCAGCCTTCAACATGTTCATCATCATTGGCATCTGTGTCTACGTGATCCCAGACGGAGAGACTCGCAAGATCAAGCATCTACGAGTCTTCTTCATCACCGCTGCTTGGAGTATCTTTGCCTACATCTGGCTCTATATGATTCTGGCAGTCTTCTCCCCTGGTGTGGTCCAGGTTTGGGAAGGCCTCCTCACTCTCTTCTTCTTTCCAGTGTGTGTCCTTCTGGCCT

Ensembl | nº de acceso humano

ENSG00000100678

Nº de acceso NCBI

NM_033262

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SLC8A3(6547) , SLC8A3(6547)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZAV
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Guendalina Bastioli et al.
Cell death & disease, 10(2), 80-80 (2019-01-30)
Progressive accumulation of α-synuclein (α-syn) and exposure to environmental toxins are risk factors that may both concur to Parkinson's disease (PD) pathogenesis. Electrophysiological recordings of field postsynaptic potentials (fEPSPs) and Ca2+ measures in striatal brain slices and differentiated SH-SY5Y cells
Giulia Di Benedetto et al.
The FEBS journal, 286(4), 737-749 (2018-12-16)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a cytokine belonging to the TNF superfamily, is regarded as a mediator of neurotoxicity. The constitutively expressed ion exchanger Na+ /Ca2+ exchanger isoform-3 (NCX3) has been shown to protect neurons from injury. Its expression
Silvia Piccirillo et al.
Cell death & disease, 9(7), 731-731 (2018-06-30)
In brain ischemia, reduction in oxygen and substrates affects mitochondrial respiratory chain and aerobic metabolism, culminating in ATP production impairment, ionic imbalance, and cell death. The restoration of blood flow and reoxygenation are frequently associated with exacerbation of tissue injury

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico