Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU064451

Sigma-Aldrich

MISSION® esiRNA

targeting human MTMR14

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGTGACACGCATCTTTTTGATAAGGTCAGAGGCTATGACATCAAGCTGCTTCGATACCTGTCAGTCAAATACATCTGTGACCTGATGGTGGAGAACAAGAAGGTGAAGTTTGGCATGAATGTAACCTCCTCTGAGAAGGTGGACAAAGCCCAGCGCTATGCCGACTTCACTCTCCTCTCCATCCCGTATCCAGGCTGTGAATTTTTCAAGGAATATAAAGATCGGGATTACATGGCAGAAGGGCTCATATTTAACTGGAAGCAGGACTACGTTGATGCCCCATTGAGCATCCCCGACTTCCTGACTCACTCTCTGAACATTGACTGGAGCCAGTATCAGTGTTGGGATCTGGTGCAACAAACACAAAACTACCTGAAGCTGCTGCTTTCCTTAGTTAACAGTGATGATGACAGCGG

Ensembl | nº de acceso humano

ENSG00000163719

Nº de acceso NCBI

NM_022485

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MTMR14(64419) , MTMR14(64419)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
CXR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhaodong Li et al.
Gene, 691, 106-113 (2018-12-27)
Myotubularin-related protein 14 (MTMR14) is a member of the myotubularin (MTM)-related protein family and plays a key role in cardiomyopathy and autophagy. However, its potential implication in human cancer is unclear. In this study, we have investigated the expression profile
Jie-Lei Zhang et al.
Cell death & disease, 11(2), 140-140 (2020-02-23)
Cardiac hypertrophy (CH) is an independent risk factor for many cardiovascular diseases, and is one of the primary causes of morbidity and mortality in elderly people. Pathological CH involves excessive protein synthesis, increased cardiomyocyte size, and ultimately the development of
Qichen Pan et al.
Biochemical and biophysical research communications, 529(4), 1045-1052 (2020-08-21)
The phosphoinositide phosphatase, myotubularinrelated protein 14 (MTMR14), plays a critical role in the regulating autophagy. However, its functional contribution to neuronal autophagy is still unclear. In the present study, we attempted to explore the effects of MTMR14 on ischemic stroke

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico