Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU063211

Sigma-Aldrich

MISSION® esiRNA

targeting human LETM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTTCGCGATGACTCGGTAGTAGAGAAGTCCCTCAAGTCCTTGAAGGACAAGAACAAGAAGCTGGAGGAAGGCGGCCCGGTGTACAGCCCCCCCGCAGAGGTGGTGGTGAAGAAGTCCCTGGGGCAGCGGGTGCTGGACGAGCTGAAGCACTACTACCATGGCTTCCGCCTGCTATGGATCGACACCAAGATCGCGGCACGCATGCTCTGGCGCATCCTCAACGGCCACAGCCTGACCCGCCGGGAGCGCAGGCAGTTTCTCCGGATCTGCGCTGACCTCTTCCGCCTGGTGCCGTTCCTTGTGTTCGTGGTGGTGCCGTTCATGGAGTTTCTGCTGCCTGTTGCTGTGAAGCTCTTCCCCAACATGTTGCCATCCACATTTGAGACTCAGTCACTCAAGGAGGAGAGGCTGAAGAAGGAGCTTCGGGTCAAGCTGGAGCTGGCCAAGTTCCTCCAGGACACCATCGAGGAGAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Clase de riesgo para el agua (WGK)

WGK 1

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lihua Piao et al.
Cancer management and research, 12, 1649-1660 (2020-03-19)
The leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) is a mitochondrial protein that has been associated with the occurrence and development of malignant tumors. Previous studies have shown that LETM1 expression is increased in several types of human cancer and
Haoyue Li et al.
Experimental and molecular pathology, 112, 104333-104333 (2019-11-11)
Leucine zipper-EF-hand containing transmembrane protein 1 (LETM1) is closely linked to the occurrence and development of many malignant tumors. Many studies have reported that enhanced expression of LETM1 in several types of human cancers was associated with poor clinical outcomes;
Lesley Hart et al.
Disease models & mechanisms, 7(5), 535-545 (2014-03-15)
Wolf-Hirschhorn syndrome (WHS) represents an archetypical example of a contiguous gene deletion disorder - a condition comprising a complex set of developmental phenotypes with a multigenic origin. Epileptic seizures, intellectual disability, growth restriction, motor delay and hypotonia are major co-morbidities

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico