Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU061141

Sigma-Aldrich

MISSION® esiRNA

targeting human KALRN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTCAAGGATCTGGGCATTGTGGTGGAGGGCTTCATGAAGAGAATAGAAGAAAAGGGTGTCCCTGAGGATATGCGAGGAAAGGACAAAATCGTGTTTGGAAATATTCATCAGATTTATGACTGGCATAAGGATTTTTTCCTGGCGGAACTGGAAAAGTGTATCCAGGAGCAAGACAGATTGGCACAGCTCTTTATTAAGCACGAGCGGAAGCTGCACATCTACGTGTGGTATTGTCAGAATAAGCCGCGCTCAGAGTACATCGTTGCTGAGTATGACGCCTACTTTGAGGAGGTAAAACAGGAGATAAATCAGAGGCTGACACTGAGTGACTTCCTCATCAAGCCCATTCAGAGAATAACAAAATACCAGTTGCTCCTCAAGGACTTCCTGAGATACAGTGAGAAGGCTGGTTTGGAGTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Caixia Zang et al.
Molecular neurobiology, 56(4), 2870-2880 (2018-08-02)
Neuroinflammation has been implicated as an important factor in the neurodegenerative diseases, and multiple candidates with anti-inflammatory effects have been shown to be beneficial for the treatment of neurodegenerative diseases. Our previous study demonstrated that a novel synthetic phloroglucinol derivative
Mengyuan Li et al.
Journal for immunotherapy of cancer, 8(2) (2020-10-11)
kalirin RhoGEF kinase (KALRN) is mutated in a wide range of cancers. Nevertheless, the association between KALRN mutations and the pathogenesis of cancer remains unexplored. Identification of biomarkers for cancer immunotherapy response is crucial because immunotherapies only show beneficial effects

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico