Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU057931

Sigma-Aldrich

MISSION® esiRNA

targeting human SST

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCAGACTCCGTCAGTTTCTGCAGAAGTCCCTGGCTGCTGCCGCGGGGAAGCAGGAACTGGCCAAGTACTTCTTGGCAGAGCTGCTGTCTGAACCCAACCAGACGGAGAATGATGCCCTGGAACCTGAAGATCTGTCCCAGGCTGCTGAGCAGGATGAAATGAGGCTTGAGCTGCAGAGATCTGCTAACTCAAACCCGGCTATGGCACCCCGAGAACGCAAAGCTGGCTGCAAGAATTTCTTCTGGAAGACTTTCACATCCTGTTAGCTTTCTTAACTAGTATTGTCCATATCAGACCTCTGATCCCTCGCCCCCACACCCCATCTCTCTTCCCTAATCCTCCAAGTCTTCAGCGA

Ensembl | nº de acceso humano

ENSG00000157005

Nº de acceso NCBI

NM_001048

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SST(6750) , SST(6750)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Catherine G Tran et al.
Surgery, 169(1), 155-161 (2020-07-03)
Patients with pancreatic neuroendocrine tumors often present with metastases, which reduce survival. Molecular features associated with pancreatic neuroendocrine tumor tumorigenesis have been reported, but mechanisms of metastasis remain incompletely understood. RNA sequencing was performed on primary and metastatic pancreatic neuroendocrine
Vesa-Matti Pohjanen et al.
PloS one, 10(7), e0131553-e0131553 (2015-07-15)
Toll-like receptor 4 is a part of the innate immune system and recognizes Helicobacter pylori lipopolysaccharide. The goal of this study was to analyze the role of Toll-like receptor 4 polymorphisms +896 (rs4986790) and +1196 (rs4986791) in the pathogenesis of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico