Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU052071

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXB7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGAAGCAGAGGAGGAAGAGGAAGAGTGAGGGATGGAGAAAGGGCAGAGGAAGAGACATGAGAAAGGGAGAGGAAGAGAAGCCCAGCTCTGGGAACTGAATCAGGAAACTCAAATCGAATAGGGAAGTAAAAAAACAAAACAAAAAACAAAAAAAACAAAAAAAAAACCCTATTTAAATGAAAGGAGTTTAAAAACATTTTTTAAGGAGGGAGAAAGGAGAAATTTTGGTTTTTCAACACTGAAAAAATACTACCTATAGGAAAGTCTGTCAGGTTTGGTTTTTTTGTACAATATGAAAAGGATATTATCTACCTGTTCTGTAGCTTTCTGGAATTTACCTCCCCTTTTCTATGTTGCTATTGTAAGGTCTTTGTAAAATCTTGCAGTTTTGTAAGCCCT

Ensembl | nº de acceso humano

ENSG00000120087

Nº de acceso NCBI

NM_004502

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... HOXB7(3217) , HOXB7(3217)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei-Min Wang et al.
Oncotarget, 8(29), 47121-47135 (2017-04-30)
The homeobox-containing gene HOXB7 plays an important role in the pathogenesis and progression of many cancers, yet its role in hepatocellular carcinoma (HCC) remains unclear. This study comprehensively analyzed the expression and clinical significance of HOXB7 in HCC and explored
Longfei Dai et al.
Laboratory investigation; a journal of technical methods and pathology, 99(6), 736-748 (2019-01-22)
Homeobox B7 (HOXB7) protein is reported to be aberrantly expressed in a variety of cancers and to play an important role in multiple cellular processes. However, the specific mechanism by which HOXB7 promotes the malignant progression of intrahepatic cholangiocarcinoma (ICC)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico