Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU051621

Sigma-Aldrich

MISSION® esiRNA

targeting human GADD45A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCACTTCACCCTGATCCAGGCGTTTTGCTGCGAGAACGACATCAACATCCTGCGCGTCAGCAACCCGGGCCGGCTGGCGGAGCTCCTGCTCTTGGAGACCGACGCTGGCCCCGCGGCGAGCGAGGGCGCCGAGCAGCCCCCGGACCTGCACTGCGTGCTGGTGACGAATCCACATTCATCTCAATGGAAGGATCCTGCCTTAAGTCAACTTATTTGTTTTTGCCGGGAAAGTCGCTACATGGATCAATGGGTTCCAGTGATTAATCTCCCTGAACGGTGATGGCATCTGAATGAAAATAACTGAACCAAATTGCACTGAAGTTTTTGAAATACCTTTGTAGTTACTCAAGCAGTTACTCCCTACACTGATGCAAGGATTACAGAAACTGATGCCAAGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yan Tan et al.
Experimental cell research, 370(2), 718-724 (2018-07-29)
Long non-coding RNA (lncRNA) are key regulatory molecules that are implicated in diverse biological processes and human diseases, including preeclampsia. However, their expression and functions in the progression of preeclampsia remains largely unclear. In this study, lncRNA DLX6-AS1 was confirmed
Pei Ma et al.
Molecular therapy. Nucleic acids, 22, 382-395 (2020-11-25)
Long noncoding RNAs (lncRNAs), genomic "dark matter," are deeply involved in diverse biological processes. The lncRNA nuclear paraspeckle assembly transcript 1 (NEAT1) is a highly participatory lncRNA; however, its roles in gastric cancer (GC) remain largely unexplored. Here, we demonstrated
Rui-Xue Sun et al.
Gene, 763, 145030-145030 (2020-08-07)
To investigate the impact and the mechanism of Gadd45α mediating p38MAPK pathway on the retinal ganglion cells (RGCs) injury in chronic ocular hypertension (COH) rats. COH model in rats were established and intraocular pressure (IOP) was tested. Retrograde labeling was
B Wang et al.
Journal of molecular cell biology, 9(4), 338-349 (2017-10-11)
Retinoic acid (RA), a bioactive metabolite of vitamin A, is a critical mediator of cell differentiation. RA blocks adipogenesis, but mechanisms remain to be established. ZFP423 is a key transcription factor maintaining white adipose identity. We found that RA inhibits

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico