Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU049401

Sigma-Aldrich

MISSION® esiRNA

targeting human UCHL5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAACTTGCAGAGGAGGAACCCATGGATACAGATCAAGGTAATAGTATGTTAAGTGCTATTCAGTCAGAAGTTGCCAAAAATCAGATGCTTATTGAAGAAGAAGTACAGAAATTAAAAAGATACAAGATTGAGAATATCAGAAGGAAGCATAATTATCTGCCTTTCATTATGGAATTGTTAAAGACTTTAGCAGAACACCAGCAGTTAATACCACTAGTAGAAAAGGCAAAAGAAAAACAGAACGCAAAGAAAGCTCAGGAAACCAAATGAAGATGTTTTCAGATATGTACACATTTCTGCTTCTGCACATATTTTCATGGAAACCATTATGTATAAAGAACTTAGAGCAACATCCTAATTGGCTCAGTGCACGTTTGGCAATAGTGCCAGCCTGTCTTGTCT

Ensembl | nº de acceso humano

ENSG00000116750

Nº de acceso NCBI

NM_015984

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... UCHL5(51377) , UCHL5(51377)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
XZU
OWU
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wonhee Han et al.
Scientific reports, 7, 42590-42590 (2017-02-16)
The Tcf/Lef family of transcription factors mediates the Wnt/β-catenin pathway that is involved in a wide range of biological processes, including vertebrate embryogenesis and diverse pathogenesis. Post-translational modifications, including phosphorylation, sumoylation and acetylation, are known to be important for the
Jieru Zhang et al.
Journal of Cancer, 11(22), 6675-6685 (2020-10-14)
Lung cancer is one of the most common malignant tumors in the world, with a high rate of malignancy and mortality. Seeking new biomarkers and potential drug targets is urgent for effective treatment of the disease. Deubiquitinase UCHL5/UCH37, as an
Susu Guo et al.
Cell death & disease, 12(1), 42-42 (2021-01-09)
The regulation of homeostasis in the Ubiquitin (Ub) proteasome system (UPS) is likely to be important for the development of liver cancer. Tribbles homolog 2 (TRIB2) is known to affect Ub E3 ligases (E3s) in liver cancer. However, whether TRIB2
Evangel Kummari et al.
PloS one, 10(8), e0135531-e0135531 (2015-08-13)
Although protein ubiquitination has been shown to regulate multiple processes during host response to Salmonella enterica serovar Typhimurium infection, specific functions of host deubiquitinating enzymes remain unknown in this bacterial infection. By using chemical proteomics approach, in which deubiquitinating enzymes

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico