Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU048931

Sigma-Aldrich

MISSION® esiRNA

targeting human PIM2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGGCATCCTCCTCTATGACATGGTGTGTGGGGACATTCCCTTTGAGAGGGACCAGGAGATTCTGGAAGCTGAGCTCCACTTCCCAGCCCATGTCTCCCCAGACTGCTGTGCCCTAATCCGCCGGTGCCTGGCCCCCAAACCTTCTTCCCGACCCTCACTGGAAGAGATCCTGCTGGACCCCTGGATGCAAACACCAGCCGAGGATGTACCCCTCAACCCCTCCAAAGGAGGCCCTGCCCCTTTGGCCTGGTCCTTGCTACCCTAAGCCTGGCCTGGCCTGGCCTGGCCCCCAATGGTCAGAAGAGCCATCCCATGGCCATGTCACAGGGATAGATGGACATTTGTTGACTTGGTTTTACAGGTCATTACCAGTCATTAAAGTCCAGTATTACTAAGGTAAGGGATTGAGGATCAGGGGTTAGAAGACATAAACCAAGTCTGCCCAGTTCCCTTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

J R Nair et al.
Leukemia, 31(8), 1715-1726 (2016-12-23)
The PIM kinase family (PIM1, 2 and 3) have a central role in integrating growth and survival signals, and are expressed in a wide range of solid and hematological malignancies. We now confirm that PIM2 is overexpressed in multiple myeloma
Zhaoyun Liu et al.
Oncology letters, 17(6), 5395-5402 (2019-06-13)
PIM2 proto-oncogene, serine/threonine kinase (PIM2) is a serine/threonine protein kinase that is upregulated in different types of cancer and serves essential roles in the regulation of signal transduction cascades, which promote cell survival and cell proliferation. The present study demonstrated
Chune Ren et al.
Molecular oncology, 12(5), 690-704 (2018-03-24)
Tristetraprolin (TTP) is an AU-rich element-binding protein that regulates mRNA stability and plays important roles in cancer. The mechanisms by which TTP is regulated in breast cancer are poorly understood. Using multiple biochemical approaches, we found that proviral insertion in
Tingting Yang et al.
Oncogene, 37(45), 5997-6009 (2018-07-10)
Hexokinase-II (HK2) is a key enzyme involved in glycolysis, which is required for breast cancer progression. However, the underlying post-translational mechanisms of HK2 activity are poorly understood. Here, we showed that Proviral Insertion in Murine Lymphomas 2 (PIM2) directly bound

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico