Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU038231

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFAIP6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTG

Ensembl | nº de acceso humano

ENSG00000123610

Nº de acceso NCBI

NM_007115

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TNFAIP6(7130) , TNFAIP6(7130)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shengchao Zhang et al.
Stem cell research & therapy, 12(1), 50-50 (2021-01-11)
Muscle stem cells (MuSCs) are absolutely required for the formation, repair, and regeneration of skeletal muscle tissue. Increasing evidence demonstrated that tissue stem cells, especially mesenchymal stem cells (MSCs), can exert therapeutic effects on various degenerative and inflammatory disorders based
Xifeng Li et al.
Journal of stroke and cerebrovascular diseases : the official journal of National Stroke Association, 29(12), 104986-104986 (2020-09-30)
Early brain injury (EBI) refers to acute brain injury during the first 72 h after subarachnoid hemorrhage (SAH), which is one of the major causes of poor prognosis after SAH. Here, we investigated the effect and the related mechanism of
Hyun Beom Song et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 26(1), 162-172 (2018-01-05)
The cornea is a transparent tissue devoid of blood and lymphatic vessels. However, various inflammatory conditions can cause hemangiogenesis and lymphangiogenesis in the cornea, compromising transparency and visual acuity. Mesenchymal stem/stromal cells (MSCs) have therapeutic potentials in a variety of
Young In Yun et al.
Cytotherapy, 19(1), 28-35 (2016-11-15)
Mesenchymal stromal cells (MSCs) offer tremendous potential for therapeutic applications for inflammatory diseases. However, tissue-derived MSCs, such as bone marrow-derived MSCs (BM-MSCs), have considerable donor variations and limited expandability. It was recently demonstrated that MSCs derived from induced pluripotent stem
Ju-Hyun An et al.
PloS one, 15(2), e0220756-e0220756 (2020-02-11)
Adipose tissue derived mesenchymal stem/stromal cell (ASC)-derived extracellular vesicles (EV) have been reported to be beneficial against dextran sulfate sodium (DSS)-induced colitis in mice. However, the underlying mechanisms have not been fully elucidated. We hypothesize that the tumor necrosis factor-α-stimulated
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico