Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU036931

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG12

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGAACCATCCAAGGACTCATTGACTTCATCAAAAAGTTTCTTAAACTTGTGGCCTCAGAACAGTTGTTTATTTATGTGAATCAGTCCTTTGCTCCTTCCCCAGACCAAGAAGTTGGAACTCTCTATGAGTGTTTTGGCAGTGATGGTAAACTGGTTTTACATTACTGCAAGTCTCAGGCGTGGGGATGAACCACAAAGAAAATCAACTTGCTACTACATGAAATGGATTTTCACGGAAGAGACAGCTCTGAAAAGTTTTGATGCTTGTGGCAAGAGACTTAACAGATGTGATCTATTTAGTATGTGTCTACTCTATGTTTATGCATAAGAAAACATCCATAGCATGAATGGACTCAGAAAAATGTGATTTGTATTAATGCACCAGTCATCATAAAAGATGGTCATGATAGTACACCCATTGCTCCTACTTGTTACTATTATTGCTGCAGATCTGCCTCCAAGGTTGAAA

Ensembl | nº de acceso humano

ENSG00000145782

Nº de acceso NCBI

NM_004707

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ATG12(9140) , ATG12(9140)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
XZU
ZYU
OWU
WPS
SGT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yingqiang Liu et al.
Cell death & disease, 11(3), 175-175 (2020-03-08)
Colorectal cancer (CRC) is a global healthcare problem. Radioresistance is a huge setback for CRC radiotherapy. In this text, the roles and molecular mechanisms of long non-coding RNA HOTAIR in CRC tumorigenesis and radioresistance were further investigated. ATG12 mRNA, HOTAIR
Sachiko Matsuzaki et al.
British journal of pharmacology, 175(10), 1637-1653 (2018-02-20)
A high recurrence rate after medical treatment is a major clinical problem for patients with endometriosis. Here, we have evaluated the in vitro effects of combined treatment with MK2206 (an AKT inhibitor) + chloroquine on cell growth and regrowth of endometriotic stromal
Yongqiang Chen et al.
Cancers, 13(5) (2021-04-04)
The epidermal growth factor receptor (EGFR) family member erb-b2 receptor tyrosine kinase 2 (ERBB2) is overexpressed in many types of cancers leading to (radio- and chemotherapy) treatment resistance, whereas the underlying mechanisms are still unclear. Autophagy is known to contribute
Sun-Jung Cho et al.
Autophagy, 11(1), 100-112 (2014-12-09)
Autophagy is one of the main mechanisms in the pathophysiology of neurodegenerative disease. The accumulation of autophagic vacuoles (AVs) in affected neurons is responsible for amyloid-β (Aβ) production. Previously, we reported that SUMO1 (small ubiquitin-like modifier 1) increases Aβ levels.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico