Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU035311

Sigma-Aldrich

MISSION® esiRNA

targeting human DKK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCAGACTGTGCCTCAGGATTGTGTTGTGCTAGACACTTCTGGTCCAAGATCTGTAAACCTGTCCTGAAAGAAGGTCAAGTGTGTACCAAGCATAGGAGAAAAGGCTCTCATGGACTAGAAATATTCCAGCGTTGTTACTGTGGAGAAGGTCTGTCTTGCCGGATACAGAAAGATCACCATCAAGCCAGTAATTCTTCTAGGCTTCACACTTGTCAGAGACACTAAACCAGCTATCCAAATGCAGTGAACTCCTTTTATATAATAGATGCTATGAAAACCTTTTATGACCTTCATCAACTCAATCCTAAGGATATACAAGTTCTGTGGTTTCAGTTAAGCATTCCAATAACACCTTCCAAAAACCTGGAGTGTAAGAGCTTTGTTTCTTTATGGAACTCCCCTGTGATTG

Ensembl | human accession no.

ENSG00000107984

NCBI accession no.

NM_012242

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DKK1(22943) , DKK1(22943)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ruirui Cheng et al.
Oncology reports, 37(4), 2129-2136 (2017-03-30)
The number of new lung cancer cases diagnosed yearly is high, and the mortality rate has not substantially declined. Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, and adenocarcinoma accounts for the largest proportion of
Shusuke Ueda et al.
Medical molecular morphology, 48(2), 69-75 (2014-05-14)
Osteonecrosis is a major glucocorticoid-induced complication in the orthopedics field. Despite the extensive researches, mechanisms underlining the glucocorticoid-induced osteonecrosis are largely unknown. Here, we first provide the evidence that a combined treatment of cultured osteocytic cells with glucocorticoid and hypoxia
A J Browne et al.
Cell death & disease, 7, e2119-e2119 (2016-02-26)
The Wnt inhibitor Dickkopf-1 (DKK-1) has been associated with the occurrence of bone metastases in osteotropic prostate cancer by inhibiting osteoblastogenesis. P38 mitogen-activated protein kinase (MAPK) activity is also dysregulated in advanced prostate cancer. However, the impact of p38 MAPK
Hua Li et al.
Anti-cancer agents in medicinal chemistry, 18(14), 2010-2016 (2018-12-07)
Gastric adenocarcinoma is one of the most common and lethal cancer types and is known as the second leading cause of cancer-related death of Asian adults, early diagnosis based on either pathology or molecular biology could be one of the
Sandra Jumpertz et al.
Cellular signalling, 34, 38-46 (2017-02-24)
The COP9 signalosome (CSN) is a multi-protein complex that is highly conserved in eukaryotes. Due to its regulatory impact on processes such as cell cycle, DNA damage response and apoptosis, the CSN is essential for mammalian cells. One of the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico