Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU034321

Sigma-Aldrich

MISSION® esiRNA

targeting human CP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAATGGACTGTCCCCAAAGAAGTAGGACCCACTAATGCAGATCCTGTGTGTCTAGCTAAGATGTATTATTCTGCTGTGGAACCCACTAAAGATATATTCACTGGGCTTATTGGGCCAATGAAAATATGCAAGAAAGGAAGTTTACATGCAAATGGGAGACAGAAAGATGTAGACAAGGAATTCTATTTGTTTCCTACAGTATTTGATGAGAATGAGAGTTTACTCCTGGAAGATAATATTAGAATGTTTACAACTGCACCTGATCAGGTGGATAAGGAAGATGAAGACTTTCAGGAATCTAATAAAATGCACTCCATGAATGGATTCATGTATGGGAATCAGCCGGGTCTCACTATGTGCAAAGGAGATTCGGTCGTGTGGTACTTATTCAGCGCCGGAAATGAGGCCGATGTACATGGAATATACTTTTCAGGAAACACATATCTGTGGAGAGGAGAACGGAGAGACACAGC

Ensembl | human accession no.

ENSG00000047457

NCBI accession no.

NM_000096

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CP(1356) , CP(1356)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yi Zhang et al.
Experimental cell research, 358(2), 234-241 (2017-07-01)
Neddylation inhibitor Pevonedistat (MLN4924) is a novel anticancer drug and has demonstrated broad-spectrum anticancer activity. Nevertheless, we found that Pevonedistat had only a modest apoptotic effect in osteosarcoma (OS) cells. Moreover, we noted that inhibition of neddylation by Pevonedistat led
Pei-Wen Wang et al.
International journal of molecular sciences, 20(18) (2019-09-25)
Wilson's disease (WD) is an autosomal recessive disorder of copper metabolism caused by defects in the ATPase gene (ATP7B). The various clinical features result from the massive accumulation of copper in the liver, cornea and basal ganglia. Although WD can
H-L Huang et al.
Oncogenesis, 6(7), e359-e359 (2017-07-12)
MUC1-C overexpression has been associated with the progression of pancreatic tumors by promoting the aggressive and metastatic phenotypes. As MUC1 is a STAT3 target gene, STAT3 plays a major role in regulating MUC1-C expression. In this study, we report an
Gang Liu et al.
Cell death & disease, 10(10), 688-688 (2019-09-20)
CELF6, a member of the CELF family of RNA-binding proteins, regulates muscle-specific alternative splicing and contributes to the pathogenesis of myotonic dystrophy (DM), however the role of CELF6 in cancer cell proliferation is less appreciated. Here, we show that the
Seong Hye Park et al.
Oncogene, 39(1), 136-150 (2019-08-30)
Hypoxia, or the deficiency of oxygen, in solid tumors is majorly responsible for the progression of cancer and remains unaffected by chemotherapy, but still requires definitive definition of the hypoxia signaling. Hypoxia disrupts the complete folding of mitochondrial proteins, leading
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico