Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU033391

Sigma-Aldrich

MISSION® esiRNA

targeting human MGMT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGGCTGAATGCCTATTTCCACCAGCCCGAGGCTATCGAAGAGTTCCCCGTGCCGGCTCTTCACCATCCCGTTTTCCAGCAAGAGTCGTTCACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGAAATTCGGAGAAGTGATTTCTTACCAGCAATTAGCAGCCCTGGCAGGCAACCCCAAAGCCGCGCGAGCAGTGGGAGGAGCAATGAGAGGCAATCCTGTCCCCATCCTCATCCCGTGCCACAGAGTGGTCTGCAGCAGCGGAGCCGTGGGCAACTACTCCGGAGGACTGGCCGTGAAGGAATGGCTTCTGGCCCATGAAGGCCACCGGTTGGGGAAGCCAGGCTTGGGAGGGAGCTCAGGTCTGGCAGGGGCCTGGCTCAAGGGAGCGGGAGCTACCTCGGGCTCCCCGCCTGCTGGCCGAAACTGAGTATGTGCAGTAGGATGGATGTTTGAGCGACACACACGTGTA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xinwei Li et al.
Pathology oncology research : POR, 26(2), 707-714 (2019-02-04)
Primary central nervous system lymphoma (PCNSL) is an aggressive and rare subtype of non-Hodgkin lymphoma, arising exclusively in the CNS with a poor prognosis. Previous evidence has proved that MGMT was a promising target involving in TMZ resistance of PCNSL.
Thatchawan Thanasupawat et al.
Molecular oncology, 11(8), 1078-1098 (2017-05-14)
The multikinase inhibitor and FDA-approved drug dovitinib (Dov) crosses the blood-brain barrier and was recently used as single drug application in clinical trials for GB patients with recurrent disease. The Dov-mediated molecular mechanisms in GB cells are unknown. We used
Jin Cheng et al.
Toxicology, 389, 67-73 (2017-07-20)
N-methyl-2,2-di(chloroethyl)amine (HN2) is a kind of bifunctional alkyltating agent, which can react with nucleophilic groups in DNA and/or protein to form HN2-bridged crosslinking of target molecules, such as DNA-protein crosslinkings (DPC). O
Lucio Tentori et al.
BMC cancer, 14, 151-151 (2014-03-07)
Chemoresistance of glioblastoma multiforme (GBM) has been attributed to the presence within the tumor of cancer stem cells (GSCs). The standard therapy for GBM consists of surgery followed by radiotherapy and the chemotherapeutic agent temozolomide (TMZ). However, TMZ efficacy is
Boswellic acid has anti-inflammatory effects and enhances the anticancer activities of Temozolomide and Afatinib, an irreversible ErbB family blocker, in human glioblastoma cells.
Manlio Barbarisi et al.
Phytotherapy research : PTR, 33(6), 1670-1682 (2019-03-30)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico