Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU033221

Sigma-Aldrich

MISSION® esiRNA

targeting human TYROBP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGGCTGTAAGTGGTCTCCGTCCTGTCCAGGCCCAGGCCCAGAGCGATTGCAGTTGCTCTACGGTGAGCCCGGGCGTGCTGGCAGGGATCGTGATGGGAGACCTGGTGCTGACAGTGCTCATTGCCCTGGCCGTGTACTTCCTGGGCCGGCTGGTCCCTCGGGGGCGAGGGGCTGCGGAGGCAGCGACCCGGAAACAGCGTATCACTGAGACCGAGTCGCCTTATCAGGAGCTCCAGGGTCAGAGGTCGGATGTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAATGAGCCCGAATCATGACAGTCAGCAACATGATACCTGGATCCAGCCATTCCTGAAGCCCACCCTGCACCTCATTCCAACTCCTACCGCGATACAGACCCACAGAGTGCCATCCCTGAGAGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Teng Jiang et al.
Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology, 39(13), 2949-2962 (2014-07-23)
Triggering receptor expressed on myeloid cells 2 (TREM2) gene is a recently identified susceptibility gene for Alzheimer's disease (AD), as its low-frequency variants increase the risk of this disease with an odds ratio similar to that of an APOE ɛ4
Tania N Crotti et al.
Arthritis research & therapy, 14(6), R245-R245 (2012-11-14)
The immunoreceptor tyrosine-based activation motif (ITAM) pathway provides osteoclast co-stimulatory signals and regulates proliferation, survival and differentiation of effector immune cells. In the osteoclast, the receptors Triggering Receptor Expressed on Myeloid cells 2 (TREM2) and Osteoclast Associated Receptor (OSCAR) and
Kevin Carrasco et al.
Cellular & molecular immunology, 16(5), 460-472 (2018-03-24)
The triggering receptor expressed on myeloid cells-1 (TREM-1) is a receptor expressed on innate immune cells. By promoting the amplification of inflammatory signals that are initially triggered by Toll-like receptors (TLRs), TREM-1 has been characterized as a major player in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico