Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU033021

Sigma-Aldrich

MISSION® esiRNA

targeting human ZNF609

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACCAACAGCCCTGCATACTCTGACATCTCTGATGCTGGGGAGGATGGGGAGGGCAAGGTAGACAGTGTCAAATCAAAGGACGCCGAACAGTTGGTTAAAGAAGGGGCTAAGAAAACTCTTTTTCCCCCTCAGCCTCAGAGCAAAGACTCACCATATTACCAAGGCTTTGAGAGTTACTATTCTCCAAGTTATGCACAGTCCAGCCCTGGGGCTCTGAACCCCAGCAGCCAGGCAGGAGTGGAGAGCCAGGCCCTGAAGACAAAAAGGGATGAGGAACCTGAGAGCATAGAAGGGAAAGTGAAGAACGATATCTGTGAAGAAAAGAAGCCCGAGCTGAGCAGTTCCAGTCAGCAGCCCTCGGTCATCCAGCAGCGTCCCAATATGTACATGCAGTCCCTGTACTACAACCAGTATGCCTATGTACCCCCCTATGGCTACAGCGACCAGAGTTACCACACCCACCTTCTGAGCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yunhe Xiong et al.
Journal of cellular physiology, 234(7), 10646-10654 (2018-11-28)
Circular RNA (circRNA) play important roles in the pathological processes of many diseases. By analyzing the results of the GSE100186 chip, we found that the expression of circRNA ZNF609 (circ-ZNF609) was significantly increased in renal cell carcinoma. Recently, there are
L Zhu et al.
European review for medical and pharmacological sciences, 23(7), 2817-2826 (2019-04-20)
This study aims to explore the biological function of circular RNA ZNF609 (circ-ZNF609) in regulating the occurrence and progression of nasopharyngeal carcinoma (NPC), and to investigate the possible underlying mechanism. The expression levels of circ-ZNF609, microRNA-150-5p and Sp1 in NPC
Shaoxia Liu et al.
Journal of cellular physiology, 236(1), 79-92 (2021-01-19)
Circular RNAs (circRNAs) have been associated with lung cancer (LC), one of the most common cancers, but the underlying molecular mechanisms of the specific correlation with LC carcinogenesis remain unveiled. Quantitative real-time polymerase chain reaction was applied to examine the

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico