Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU031481

Sigma-Aldrich

MISSION® esiRNA

targeting human USP14

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCAGCAGATGCTCTTCCAGAAGAACCCTCAGCCAAAACTGTCTTCGTAGAAGACATGACAGAAGAACAGTTAGCATCTGCTATGGAGTTACCATGTGGATTGACAAACCTTGGTAACACTTGTTACATGAATGCCACAGTTCAGTGTATTCGTTCTGTGCCTGAACTCAAAGATGCCCTTAAAAGGTATGCAGGTGCCTTGAGAGCTTCAGGGGAAATGGCTTCAGCGCAGTATATTACTGCAGCCCTTAGAGATTTGTTTGATTCCATGGATAAAACTTCTTCCAGTATTCCACCTATTATTCTACTGCAGTTTTTGCACATGGCTTTCCCACAGTTTGCCGAGAAAGGTGAACAAGGACAGTATCTTCAACAGGATGCTAATGAATGTTGGATACAAATGATGCGAGTATTGCAACAGAAATTGGAAGCAATAGAGGATGATTCTGTTAAAGAGACAGACTCCTCATCTGCATCGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ying Zhu et al.
Oncotarget, 8(30), 48725-48736 (2016-07-28)
Vimentin plays important roles in the epithelial-to-mesenchymal transition (EMT). In this study, we found that vimentin was highly expressed in human gastric cancer (GC) tissues and cell lines and significantly promoted cell growth, migration and invasion. Ubiquitin-specific protease 14 (USP14)
Vignesh Srinivasan et al.
iScience, 23(1), 100790-100790 (2020-01-07)
USP14 is a deubiquitinating enzyme associated with the proteasome important for protein degradation. Here we show that upon proteasome inhibition or expression of the mutant W58A-USP14, association of USP14 with the 19S regulatory particle is disrupted. MS-based interactomics revealed an
Susu Guo et al.
Cell death & disease, 12(1), 42-42 (2021-01-09)
The regulation of homeostasis in the Ubiquitin (Ub) proteasome system (UPS) is likely to be important for the development of liver cancer. Tribbles homolog 2 (TRIB2) is known to affect Ub E3 ligases (E3s) in liver cancer. However, whether TRIB2

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico