Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU029441

Sigma-Aldrich

MISSION® esiRNA

targeting human MEX3C

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATATTGCCATGCGTACAGGAAACTATATAGAGCTCAATGAAGAGAATGATTTCCATTACAATGGTACCGATGTAAGCTTTGAAGGTGGCACTCTTGGCTCTGCGTGGCTCTCCTCCAATCCTGTTCCTCCTAGCCGCGCAAGAATGATATCCAATTATCGAAATGATAGTTCCAGTTCTCTAGGAAGTGGCTCTACAGATTCCTACTTTGGAAGCAATAGGCTGGCTGACTTTAGTCCAACAAGCCCATTTAGCACAGGAAACTTCTGGTTTGGAGATACACTACCATCTGTAGGCTCAGAAGACCTAGCAGTTGACTCTCCTGCCTTTGACTCTTTACCAACATCTGCTCAAACTATCTGGACTCCATTTGAACCAGTTAACCCACTCTCTGGCTTTGGGAGTGATCCTTCTGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qingsong Hu et al.
Cell research, 29(4), 286-304 (2019-01-12)
Despite the structural conservation of PTEN with dual-specificity phosphatases, there have been no reports regarding the regulatory mechanisms that underlie this potential dual-phosphatase activity. Here, we report that K27-linked polyubiquitination of PTEN at lysines 66 and 80 switches its phosphoinositide/protein
Pin Lu et al.
PloS one, 12(10), e0185992-e0185992 (2017-10-06)
Some RNA species, especially microRNAs, are non-randomly sorted into exosomes, but how selectivity of RNA exosomal sorting is achieved is unknown. We found that all three variants of RNA-binding ubiquitin E3 ligase (MEX3C)-MEX3C-1, MEX3C-2, and MEX3C-3 -interact with adaptor-related protein
Yajuan Li et al.
The Journal of clinical investigation, 129(3), 1129-1151 (2019-02-12)
Epithelial-mesenchymal transition (EMT) contributes significantly to interstitial matrix deposition in diabetic kidney disease (DKD). However, detection of EMT in kidney tissue is impracticable, and anti-EMT therapies have long been hindered. We reported that phosphatase and tensin homolog (PTEN) promoted transforming

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico