Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU024671

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGGTGTTGGAACTCGCCATAAGGCATTGATCAGGATTATGGTTTCCCGTTCTGAAATTGACATGAATGATATCAAAGCATTCTATCAGAAGATGTATGGTATCTCCCTTTGCCAAGCCATCCTGGATGAAACCAAAGGAGATTATGAGAAAATCCTGGTGGCTCTTTGTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hisashi Onozawa et al.
Oncology reports, 37(1), 235-240 (2016-11-15)
Resistance to 5-fluorouracil (5‑FU), a key drug in the treatment of colorectal cancer, is one of the major reasons for poor patient prognosis during cancer treatment. Annexin A1 (ANXA1) is a calcium‑dependent phospholipid‑linked protein that is associated with drug resistance, anti‑inflammatory effects
Yin Zhao et al.
Biochimica et biophysica acta, 1863(6), 1350-1358 (2017-04-09)
The degeneration of retinal ganglion cells (RGCs) has been identified as a major problem in glaucoma. Previous studies have indicated an association between annexin A1 (ANXA1) and neuronal cell apoptosis, and RGCs apoptosis in acute ischemia-reperfusion was attributed to an
Chandrika Senthilkumaran et al.
Veterinary research, 46, 6-6 (2015-04-02)
Annexins A1 and A2 are proteins known to function in the stress response, dampening inflammatory responses and mediating fibrinolysis. We found, in healthy cattle recently arrived to a feedlot, that lower levels of these proteins correlated with later development of
Anjana Bhardwaj et al.
PloS one, 10(5), e0127678-e0127678 (2015-05-23)
Annexin A1 (ANXA1) is an anti-inflammatory protein reported to play a role in cell proliferation and apoptosis, and to be deregulated in breast cancer. The exact role of annexin A1 in the biology of breast cancer remains unclear. We hypothesized

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico