Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU024041

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGCTTCCTGGAGACTTTGAAGACAGAGCGGCTGAGCCCAGACCTCCTGACCCTGGGACCTGCACTGCCTTCATCACTCCCTGTCCCCAATAGTGCTTATGGGGGCCCTGACTTTTCCAGTACCTTCTTTTCTCCCACCGGGAGCCCCCTCAATTCAGCAGCCTATTCCTCTCCCAAGCTTCGTGGAACTCTCCCCCTGCCTCCCTGTGAGGCCAGGGAGTGTGTGAACTGCGGAGCAACAGCCACTCCACTGTGGCGGAGGGACAGGACAGGCCACTACCTATGCAACGCCTGCGGCCTCTATCACAAGATGAATGGGCAGAACAGGCCCCTCATCCGGCCCAAGAAGCGCCTGATTGTCAGTAAACGGGCAGGTACTCAGTGCACCAACTGCCAGACGACCACCACGACACTGTGGCGGAGAAATGCCAGTGGGGATCCCGTGTGCAATGCCTGCGGCCTCTACTACAAGCTACACCAGGTGAACCG

Ensembl | human accession no.

ENSG00000102145

NCBI accession no.

NM_002049

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GATA1(2623) , GATA1(2623)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Anouck Wijgaerts et al.
Haematologica, 102(4), 695-706 (2017-01-14)
Gray platelet syndrome is named after the gray appearance of platelets due to the absence of α-granules. It is caused by recessive mutations in
Miranda L Xu et al.
Journal of neurochemistry, 146(4), 390-402 (2018-04-21)
Acetylcholinesterase (AChE; EC 3.1.1.7) is known to hydrolyze acetylcholine at cholinergic synapses. In mammalian erythrocyte, AChE exists as a dimer (G2 ) and is proposed to play role in erythropoiesis. To reveal the regulation of AChE during differentiation of erythroblast
John Timothy Caldwell et al.
PloS one, 8(7), e68601-e68601 (2013-07-23)
It has been previously shown that acute myeloid leukemia (AML) patients with higher levels of GATA1 expression have poorer outcomes. Furthermore, pediatric Down syndrome (DS) patients with acute megakaryocytic leukemia (AMKL), whose blast cells almost universally harbor somatic mutations in
Ram Ajore et al.
BMC molecular biology, 13, 11-11 (2012-03-27)
MTG16, MTGR1 and ETO are nuclear transcriptional corepressors of the human ETO protein family. MTG16 is implicated in hematopoietic development and in controlling erythropoiesis/megakaryopoiesis. Furthermore, ETO homologue genes are 3'participants in leukemia fusions generated by chromosomal translocations responsible of hematopoietic
A Maroz et al.
Leukemia, 28(6), 1259-1270 (2013-12-18)
Transient leukemia (TL) is evident in 5-10% of all neonates with Down syndrome (DS) and associated with N-terminal truncating GATA1 mutations (GATA1s). Here we report that TL-cell clones generate abundant eosinophils in a substantial fraction of patients. Sorted eosinophils from
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico