Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU023041

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP6V0C, RP11-20I23.1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACTCCCTGAATGACGACATCAGCCTCTACAAGAGCTTCCTCCAGCTGGGCGCCGGCCTGAGCGTGGGCCTGAGCGGCCTGGCAGCCGGCTTTGCCATCGGCATCGTGGGGGACGCTGGCGTGCGGGGCACCGCCCAGCAGCCCCGACTATTCGTGGGCATGATCCTGATTCTCATCTTCGCCGAGGTGCTCGGCCTCTACGGTCTCATCGTCGCCCTCATCCTCTCCACAAAGTAGACCCTCTCCGAGCCCACCAGCCACAGAATATTATGTAAAGACCACCCCTCCTCATTCCAGAACGAACAGCCTGACACATACGCACGGGGCCGCCGCCCCCAGTAGTTGGTCTTGTACATGCGCAGTGTCCTAGTGCCCATCGTCTGTTTCCCCGGCCTTGCCCCCGCCCGCCCCGTGCCGTGGACATCTGGGCCCACTCATCGCCCCTCCAGGCCCCCGGCGCCCCACCCCCTAGAGTGCTCTGTGTATGCGGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nicholas J Barrows et al.
Scientific reports, 9(1), 9711-9711 (2019-07-06)
Hundreds of cellular host factors are required to support dengue virus infection, but their identity and roles are incompletely characterized. Here, we identify human host dependency factors required for efficient dengue virus-2 (DENV2) infection of human cells. We focused on
Yuji Tani et al.
Scientific reports, 5, 10878-10878 (2015-06-04)
(Pro)renin receptor (PRR) has a single transmembrane domain that co-purifies with the vacuolar H(+)-ATPase (V-ATPase). In addition to its role in cellular acidification, V-ATPase has been implicated in membrane fusion and exocytosis via its Vo domain. Results from the present
Manuela Salerno et al.
PloS one, 9(10), e110340-e110340 (2014-10-21)
Rhabdomyosarcoma is the most frequent soft tissue sarcoma in children and adolescents, with a high rate of relapse that dramatically affects the clinical outcome. Multiagent chemotherapy, in combination with surgery and/or radiation therapy, is the treatment of choice. However, the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico