Saltar al contenido
Merck

EHU020151

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGCGGGATTAATGTGTTTGGACAAATCACTGTGGAGACATTTGCTTCCATTGTTGCTCATGAATTGGGTCATAATCTTGGAATGAATCACGATGATGGGAGAGATTGTTCCTGTGGAGCAAAGAGCTGCATCATGAATTCAGGAGCATCGGGTTCCAGAAACTTTAGCAGTTGCAGTGCAGAGGACTTTGAGAAGTTAACTTTAAATAAAGGAGGAAACTGCCTTCTTAATATTCCAAAGCCTGATGAAGCCTATAGTGCTCCCTCCTGTGGTAATAAGTTGGTGGACGCTGGGGAAGAGTGTGACTGTGGTACTCCAAAGGAATGTGAATTGGACCCTTGCTGCGAAGGAAGTACCTGTAAGCTTAAATCATTTGCTGAGTGTGCATATGGTGACTGTTGTAAAGACTGTCGGTTCCTTCCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Rui Zhou et al.
Frontiers in medicine, 7, 214-214 (2020-07-09)
Upregulation of a disintegrin and metalloprotease 9 (ADAM9) is correlated with progression of cancers, such as prostate, bladder, and pancreatic cancers. However, its role in triple-negative breast cancer (TNBC) is still unclear. Our study aimed to investigate whether ADAM9 is
Liang Chang et al.
Molecular medicine reports, 12(1), 1197-1204 (2015-03-18)
A disintegrin and metalloproteinase 9 (ADAM9) is a type I transmembrane protein that has been associated with cancer development and metastasis in various types of cancer. However, little is known about its role in non-small cell lung cancer (NSCLC). The
Mari Ueno et al.
Cancer science, 109(2), 471-482 (2017-12-17)
ADAMs (a disintegrin and metalloproteinases) are involved in various biological events such as cell adhesion, migration and invasion, membrane protein shedding and proteolysis. However, there have been no systematic studies on the expression of ADAMs in human ovarian carcinomas. We
Jun Arai et al.
Journal of gastroenterology and hepatology, 33(5), 1075-1081 (2017-10-22)
The multi-kinase inhibitor regorafenib (REG) was recently demonstrated to be effective in patients with sorafenib (SOR)-resistant hepatocellular carcinoma (HCC). Interestingly, SOR is known to enhance the accumulation of membrane-bound MHC class I polypeptide-related sequence A (mMICA) in HCC cells and
Jun Arai et al.
Cancer immunology, immunotherapy : CII, 70(1), 203-213 (2020-07-20)
In our previous genome-wide association study, we demonstrated the association between MHC class I-related chain A (MICA) and hepatocellular carcinoma (HCC) development in patients with chronic hepatitis C. Increasing membrane-bound MICA (mMICA) in cancer cells by reducing MICA sheddases facilitates

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico