Saltar al contenido
Merck

EHU016661

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC25A37

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGAATCCAGCAGAAGTGGTGAAGCAGCGCTTGCAGATGTACAACTCGCAGCACCGGTCAGCAATCAGCTGCATCCGGACGGTGTGGAGGACCGAGGGGTTGGGGGCCTTCTACCGGAGCTACACCACGCAGCTGACCATGAACATCCCCTTCCAGTCCATCCACTTCATCACCTATGAGTTCCTGCAGGAGCAGGTCAACCCCCACCGGACCTACAACCCGCAGTCCCACATCATCTCAGGCGGGCTGGCCGGGGCCCTCGCCGCGGCCGCCACGACCCCCCTGGACGTCTGTAAGACCCTTCTGAACACTCAGGAGAACGTGGCCCTCTCGCTGGCCAACATCAGCGGCCGGCTGTCGGGTATGGCCAATGCCTTCCGGACGGTGTACCAGCTCAACGGCCCGGCTACTTCAAAGGCATCCAGGC

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kazuo Tomita et al.
Biochemical and biophysical research communications, 518(4), 712-718 (2019-09-02)
MicroRNA (miRNA) is a non-coding RNA involved in regulating both cancer gene promotion and suppression. We investigated the role of miRNA in inducing radiation resistance in cancer cell lines using clinically relevant radioresistant (CRR) cells. Analysis using miRNA arrays and
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico