Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU015351

Sigma-Aldrich

MISSION® esiRNA

targeting human AIM2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGTGTCTGCAGTGATGAAGACCATTCGTATTTTTCAGAAGTTGAATTATATGCTTTTGGCAAAACGTCTTCAGGAGGAGAAGGAGAAAGTTGATAAGCAATACAAATCGGTAACAAAACCAAAGCCACTAAGTCAAGCTGAAATGAGTCCTGCTGCATCTGCAGCCATCAGAAATGATGTCGCAAAGCAACGTGCTGCACCAAAAGTCTCTCCTCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGAAGGGTTTCAGAAGCGCTGTTTGCCAGTTATGGTACTGAAAGCAAAGAAGCCCTTCACGTTTGAGACCCAAGAAGGCAAGCAGGAGATGTTTCATGCTACAGTGGCTACAGAAAAGGAATTCTTCTTTGTAAAAGTTTTTAATACACTGCTGAAAGATAAATTCATTCCAAAGAGAATAATTATAATAGCAAGATATTATCGGCACAGTGGTTTCTTAGAGGTAAATAGCGCCTCACGTGTG

Ensembl | human accession no.

ENSG00000163568

NCBI accession no.

NM_004833

shipped in

ambient

Storage temp.

−20°C

Gene Information

human ... AIM2(9447) , AIM2(9447)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

N Yoon et al.
Cell death & disease, 7, e2191-e2191 (2016-04-15)
Our recent study showed that human mesenchymal stem/stromal cells (hMSCs) are activated to express tumor necrosis factor (TNF)-α-related apoptosis-inducing ligand (TRAIL) by exposure to TNF-α and these activated hMSCs effectively induce apoptosis in triple-negative breast cancer MDA-MB-231 (MDA) cells in
J Lee et al.
Oncogene, 31(10), 1242-1253 (2011-08-02)
Absent in Melanoma 2 (AIM2) is a member of the HIN-200 family of hematopoietic, IFN-inducible, nuclear proteins, associated with both, infection defense and tumor pathology. Recently, AIM2 was found to act as a DNA sensor in innate immunity. In addition
Yunjia Yang et al.
Journal of cellular biochemistry, 120(10), 17744-17756 (2019-06-19)
Absent in melanoma 2 (AIM2) is a critical component in natural immunity system and is closely related to cancer initiation and development. It has been shown that AIM2 inhibited colorectal cancer (CRC) development and cell proliferation. It remains unresolved how
Ying Xu et al.
Oncotarget, 8(49), 86339-86355 (2017-11-22)
Hepatic ischemia/reperfusion (I/R) contributes to major complications in clinical practice affecting perioperative morbidity and mortality. Recent evidence suggests the key role of nucleotide-binding oligomerization domain-like receptor (NLR) family pyrin domain-containing 3 (NLRP3) inflammaosme activation on the pathogenesis of I/R injury.
Miao Qi et al.
Oncogene, 39(13), 2707-2723 (2020-02-02)
Mitochondrial fusion and fission dynamics fine-tune cellular calcium homeostasis, ATP production capacity and ROS production and play important roles in cell proliferation and migration. Dysregulated mitochondrial dynamics is closely related to tumor development, but the mechanism of mitochondrial dynamics dysregulation
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico