Saltar al contenido
Merck

EHU011461

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
US$ 534,00
50 μG
US$ 953,00

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
US$ 534,00
50 μG
US$ 953,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

US$ 534,00

PRECIOS SIN IMPUESTOS NACIONALES

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCAGCCAAACTATGGGCTAGCCATTGAGGTGACTCACCTCCATCAGACTCGGACCCACCAGGGCCAGCATGTCAGGATTAGCCGATCGTTACCTCAAGGGAGTGGGAATTGGGCCCAGCTCCGGCCCCTCCTGGTCACCTTTGGCCATGATGGCCGGGGCCATGCCTTGACCCGACGCCGGAGGGCCAAGCGTAGCCCTAAGCATCACTCACAGCGGGCCAGGAAGAAGAATAAGAACTGCCGGCGCCACTCGCTCTATGTGGACTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCCCCACCAGGCTACCAGGCCTTCTACTGCCATGGGGACTGCCCCTTTCCACTGGCTGACCACCTCAACTCAACCAACCATGCCATTGTGCAGACCCTGGTCAATTCTGTCAATTCCAGTATCCCCAAAGCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaoqing Zhang et al.
Cell death discovery, 7(1), 51-51 (2021-03-17)
Alzheimer's disease (AD) is a chronic progressive degenerative disease of the nervous system. Its pathogenesis is complex and is related to the abnormal expression of the amyloid β (Aβ), APP, and Tau proteins. Evidence has demonstrated that bone morphogenetic protein
Thomas Helbing et al.
Inflammation, 40(6), 1862-1874 (2017-07-30)
Leukocyte recruitment is a fundamental event in the response of the innate immune system to injury. This process is promoted in part by the opening of endothelial cell adherens junctions that allows leukocyte extravasation through gaps between adjacent endothelial cells.
Janice Siu Chong Wong et al.
Experimental eye research, 181, 185-189 (2019-02-06)
Periorbital adipose tissue expansion is a key pathological change in thyroid associated orbitopathy (TAO). Bone morphogenic protein 4 (BMP4) is instrumental in adipogenesis. We compared site-specific BMP4 expression and its effect on adipogenesis using donor-matched adipose tissue-derived stromal cells (ADSC)
Huiming Ju et al.
Molecular medicine reports, 13(3), 2194-2200 (2016-01-20)
MicroRNA-378 (miRNA-378) has been reported to have a crucial role in skeletal muscle differentiation; however, the underlying mechanisms have largely remained to be elucidated. The present study employed high‑throughput RNA sequencing to investigate the transcriptome following transfection of miRNA‑378 mimics
Thomas Helbing et al.
Inflammation, 40(2), 442-453 (2016-12-21)
The endothelium serves as a selective barrier and controls the exchange of nutrients, hormones, and leukocytes between blood and tissues. Molecular mechanisms contributing to the pathogenesis of endothelial barrier dysfunction remain incompletely understood. Accumulating evidence implicates bone morphogenetic protein (BMP)-modulator

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico