Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU010131

Sigma-Aldrich

MISSION® esiRNA

targeting human ZEB2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGACAGATCAGCACCAAATGCTAACCCAAGGAGCAGGTAATCGCAAGTTCAAATGCACAGAGTGTGGCAAGGCCTTCAAATATAAACACCATCTGAAAGAACACCTGCGAATTCACAGTGGTGAAAAACCTTACGAGTGCCCAAACTGCAAGAAACGTTTCTCCCATTCTGGTTCCTACAGTTCGCACATCAGCAGCAAGAAATGTATTGGTTTAATCTCTGTAAATGGCCGAATGAGAAACAATATCAAGACGGGTTCTTCCCCTAATTCTGTTTCTTCTTCTCCTACTAATTCAGCCATTACCCAGTTAAGAAACAAGTTGGAGAATGGAAAACCACTTAGTATGTCTGAACAGACAGGCTTACTTAAAATTAAAACAGAACCACTAGACTTCAATGACTATAAAGTTCTTATGGCTACACACGGGTTTAGTGGCACTAGTCCCTTTATGAATGGTGGGCTTGGAGCCACCAGCCCTTTAGGAGTTCATCCATCTGCTCAGAGTCCAATGCAGCACTTAGGTG

Ensembl | human accession no.

ENSG00000169554

NCBI accession no.

NM_014795

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ZEB2(9839) , ZEB2(9839)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Steven Goossens et al.
Blood, 129(8), 981-990 (2017-01-11)
Elevated expression of the Zinc finger E-box binding homeobox transcription factor-2 (ZEB2) is correlated with poor prognosis and patient outcome in a variety of human cancer subtypes. Using a conditional gain-of-function mouse model, we recently demonstrated that ZEB2 is an
D-M Geng et al.
European review for medical and pharmacological sciences, 21(8), 1746-1752 (2017-05-10)
To investigate the effect of ZEB2 silencing on cisplatin resistance in gastric cancer. The resulting cell line, SGC7901/DDP, was transfected with ZEB2 siRNA, non-specific siRNA, or vehicle control. The effectiveness of ZEB2 silencing was evaluated by reverse transcriptase-polymerase chain reaction
Sanchari Roy et al.
Clinical science (London, England : 1979), 130(14), 1197-1207 (2016-04-30)
miR-192-5p has gained increasing relevance in various diseases, however, its function in acute liver injury is currently unknown. We analysed miR-192-5p serum levels and hepatic miR-192-5p expression in mice after hepatic ischaemia and reperfusion (I/R) as well as in toxic
Loukia N Lili et al.
Cancer letters, 428, 184-191 (2018-05-08)
Expression levels of the miR-200 family of miRNAs are significantly reduced during the epithelial-to-mesenchymal transition (EMT) and consequent metastasis of ovarian and other cancers. Consistently, ectopic over-expression of miR-200 family miRNAs in mesenchymal-like cells reverses the process by converting treated
Fahmida Jahan et al.
International journal of molecular sciences, 19(10) (2018-10-20)
Following cardiac injury, fibroblasts are activated and are termed as myofibroblasts, and these cells are key players in extracellular matrix (ECM) remodeling and fibrosis, itself a primary contributor to heart failure. Nutraceuticals have been shown to blunt cardiac fibrosis in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico