Saltar al contenido
Merck

EHU009531

Sigma-Aldrich

MISSION® esiRNA

targeting human PLA2G4A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGCCTTGGTGAGTGATTCAGCTTTATTCAATACCAGAGAAGGACGTGCTGGGAAGGTACACAACTTCATGCTGGGCTTGAATCTCAATACATCTTATCCACTGTCTCCTTTGAGTGACTTTGCCACACAGGACTCCTTTGATGATGATGAACTGGATGCAGCTGTAGCAGATCCTGATGAATTTGAGCGAATATATGAGCCTCTGGATGTCAAAAGTAAAAAGATTCATGTAGTGGACAGTGGGCTCACATTTAACCTGCCGTATCCCTTGATACTGAGACCTCAGAGAGGGGTTGATCTCATAATCTCCTTTGACTTTTCTGCAAGGCCAAGTGACTCTAGTCCTCCGTTCAAGGAACTTCTACTTGCAGAAAAGTGGGCTAAAATGAACAAGCTCCCCTTTCCAAAGATTGATCCTTATGTGTTTGATCGGGAAGGGCTGAAGGAGTGCTATGTCTTTAAACCCAAGAATCCTGATATGGAGAAAGATTGCCCAACCATCATCCACTTTGTTCTGGCCAACATCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nikos Koundouros et al.
Cell, 181(7), 1596-1611 (2020-06-20)
Oncogenic transformation is associated with profound changes in cellular metabolism, but whether tracking these can improve disease stratification or influence therapy decision-making is largely unknown. Using the iKnife to sample the aerosol of cauterized specimens, we demonstrate a new mode
Chinmoy Sarkar et al.
Autophagy, 16(3), 466-485 (2019-06-27)
Lysosomal membrane permeabilization (LMP) is observed under many pathological conditions, leading to cellular dysfunction and death. However, the mechanisms by which lysosomal membranes become leaky in vivo are not clear. Our data demonstrate that LMP occurs in neurons following controlled
Dennis Y Chuang et al.
Journal of neuroinflammation, 12, 199-199 (2015-11-02)
Oxidative stress and inflammation are important factors contributing to the pathophysiology of numerous neurological disorders, including Alzheimer's disease, Parkinson's disease, acute stroke, and infections of the brain. There is well-established evidence that proinflammatory cytokines and glutamate, as well as reactive

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico